Incidental Mutation 'R0277:Sort1'
ID65285
Institutional Source Beutler Lab
Gene Symbol Sort1
Ensembl Gene ENSMUSG00000068747
Gene Namesortilin 1
Synonymssortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3
MMRRC Submission 038499-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R0277 (G1)
Quality Score142
Status Validated
Chromosome3
Chromosomal Location108284082-108361511 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 108324592 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]
Predicted Effect probably benign
Transcript: ENSMUST00000102632
SMART Domains Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
VPS10 131 743 N/A SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135636
SMART Domains Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747

DomainStartEndE-ValueType
VPS10 1 218 2.3e-5 SMART
transmembrane domain 262 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.3%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik A G 7: 125,318,643 K69R unknown Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Acad11 T C 9: 104,124,025 M708T probably damaging Het
Adam7 T C 14: 68,510,857 probably null Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Ak3 A G 19: 29,047,792 M13T possibly damaging Het
Ap2s1 T C 7: 16,747,380 probably benign Het
Arhgef1 A T 7: 24,923,799 probably benign Het
Arsk T C 13: 76,074,932 N182S probably benign Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Atp8b3 T C 10: 80,526,909 K672E probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Casp6 T A 3: 129,910,523 V86E probably benign Het
Cdca5 A G 19: 6,090,712 E260G unknown Het
Cpb2 T A 14: 75,265,458 V159D probably damaging Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dync2h1 T C 9: 7,129,046 D1823G probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgbp G T 7: 28,085,493 probably null Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Gldc A G 19: 30,116,451 I722T possibly damaging Het
Gm10717 T G 9: 3,025,619 V68G possibly damaging Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gnl3 A C 14: 31,013,427 probably null Het
Gsto1 A T 19: 47,857,977 I88F probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hipk3 T A 2: 104,441,248 L446F probably damaging Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hsd17b6 T C 10: 127,991,405 D266G probably benign Het
Ipo4 T C 14: 55,632,115 S363G probably benign Het
Kcnip3 A G 2: 127,459,979 probably benign Het
Klhl41 A G 2: 69,671,296 Y367C probably damaging Het
Klk1b4 C G 7: 44,211,629 P232R possibly damaging Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Mark1 A G 1: 184,944,952 S34P possibly damaging Het
Megf11 G A 9: 64,691,350 probably null Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Muc4 C A 16: 32,755,690 probably benign Het
Myo18b A G 5: 112,693,347 probably benign Het
Myo9b T C 8: 71,355,952 probably benign Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg3 A G 2: 156,934,935 probably benign Het
Nfe2l3 T A 6: 51,457,468 M336K probably benign Het
Nrxn1 A C 17: 90,700,742 probably null Het
Nsun3 A T 16: 62,776,644 probably benign Het
Nuak1 T C 10: 84,374,451 E591G probably benign Het
Olfr1347 T A 7: 6,488,434 M147L probably benign Het
Olfr1511 T C 14: 52,390,389 Y128C probably damaging Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr730 T C 14: 50,186,332 N296S probably null Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Olfr982 G A 9: 40,074,714 V140I probably benign Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Ovgp1 T C 3: 105,979,892 probably benign Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pdk4 G T 6: 5,491,620 P100Q probably damaging Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Prune2 A T 19: 17,121,389 D1419V probably damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Rab11fip4 A G 11: 79,686,629 H403R possibly damaging Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Ric8a T G 7: 140,857,900 probably benign Het
Rsbn1 T C 3: 103,914,581 F44S possibly damaging Het
Serpinc1 T A 1: 160,989,702 M1K probably null Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Sipa1 A T 19: 5,654,065 M743K probably benign Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slco6b1 A T 1: 96,988,673 noncoding transcript Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Spg21 A T 9: 65,465,347 K20N possibly damaging Het
Sptbn2 A T 19: 4,745,145 I1544F probably benign Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Ssbp2 T A 13: 91,564,596 probably benign Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Sv2b A T 7: 75,206,439 D34E possibly damaging Het
Synpo2l A G 14: 20,661,788 S255P probably damaging Het
Tbx15 C T 3: 99,352,391 P526L probably damaging Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tgm1 C A 14: 55,710,927 probably benign Het
Tgm1 T C 14: 55,712,652 probably benign Het
Thsd7b A G 1: 130,195,263 I1540V probably benign Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Ube2l6 A T 2: 84,806,427 probably null Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Wdfy4 T C 14: 33,083,785 D1735G possibly damaging Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wnt5a A T 14: 28,513,268 M70L possibly damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfp455 G T 13: 67,198,664 probably null Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Sort1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sort1 APN 3 108356307 missense probably damaging 0.99
IGL01677:Sort1 APN 3 108344885 missense probably benign 0.05
IGL02532:Sort1 APN 3 108325720 missense probably benign 0.44
IGL03354:Sort1 APN 3 108348706 missense probably benign 0.00
R0266:Sort1 UTSW 3 108344931 missense probably benign 0.09
R0559:Sort1 UTSW 3 108356579 missense probably damaging 1.00
R0597:Sort1 UTSW 3 108338910 missense probably damaging 1.00
R0624:Sort1 UTSW 3 108348630 missense probably damaging 1.00
R1803:Sort1 UTSW 3 108325699 missense probably damaging 1.00
R1872:Sort1 UTSW 3 108340695 missense probably benign 0.01
R1986:Sort1 UTSW 3 108345727 missense possibly damaging 0.71
R2130:Sort1 UTSW 3 108351686 missense probably benign
R2131:Sort1 UTSW 3 108351686 missense probably benign
R2133:Sort1 UTSW 3 108351686 missense probably benign
R2362:Sort1 UTSW 3 108346665 missense possibly damaging 0.89
R3436:Sort1 UTSW 3 108337807 missense probably damaging 1.00
R3548:Sort1 UTSW 3 108337909 missense possibly damaging 0.83
R3700:Sort1 UTSW 3 108356639 nonsense probably null
R4496:Sort1 UTSW 3 108310145 missense probably benign 0.17
R4616:Sort1 UTSW 3 108355541 missense possibly damaging 0.66
R4632:Sort1 UTSW 3 108346678 missense probably damaging 1.00
R4749:Sort1 UTSW 3 108356323 nonsense probably null
R4994:Sort1 UTSW 3 108328069 missense probably damaging 0.99
R5187:Sort1 UTSW 3 108324676 missense probably damaging 1.00
R5753:Sort1 UTSW 3 108345774 missense probably damaging 1.00
R6019:Sort1 UTSW 3 108357233 missense possibly damaging 0.77
R6262:Sort1 UTSW 3 108310211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCACATAATTCTCTGCTGC -3'
(R):5'- AGGTGCTATGGAACACCAACTTCAC -3'

Sequencing Primer
(F):5'- aaccaccccattgagaactac -3'
(R):5'- CTTCACATGCAGGAATGAGTCTC -3'
Posted On2013-08-08