Incidental Mutation 'R0278:Klkb1'
ID65341
Institutional Source Beutler Lab
Gene Symbol Klkb1
Ensembl Gene ENSMUSG00000109764
Gene Namekallikrein B, plasma 1
SynonymsKlk3, Kal-3, PSA, Kal3
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R0278 (G1)
Quality Score144
Status Not validated
Chromosome8
Chromosomal Location45266689-45294859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45272409 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 498 (F498V)
Ref Sequence ENSEMBL: ENSMUSP00000026907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026907]
Predicted Effect probably benign
Transcript: ENSMUST00000026907
AA Change: F498V

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026907
Gene: ENSMUSG00000109764
AA Change: F498V

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116473
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric enzyme comprised of heavy and light chains. A complete deletion of the encoded protein prevents occlusive thrombus formation in mice with a minimal role in provoked bleeding. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced hematoma expansion in streptozotocin-induced diabetic mice subjected to autologous blood injection, and prolonged activated partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Klkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Klkb1 APN 8 45294068 splice site probably benign
IGL01756:Klkb1 APN 8 45272324 missense probably damaging 0.99
IGL01783:Klkb1 APN 8 45276391 missense probably damaging 1.00
IGL01809:Klkb1 APN 8 45276053 missense probably benign 0.00
IGL02128:Klkb1 APN 8 45287031 missense probably damaging 1.00
IGL02512:Klkb1 APN 8 45276240 splice site probably benign
E0374:Klkb1 UTSW 8 45289091 missense possibly damaging 0.58
R0048:Klkb1 UTSW 8 45289196 splice site probably benign
R0149:Klkb1 UTSW 8 45276063 missense probably damaging 1.00
R0551:Klkb1 UTSW 8 45277966 critical splice donor site probably null
R1103:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1420:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1930:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R1931:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R2125:Klkb1 UTSW 8 45275504 missense possibly damaging 0.68
R2418:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R2419:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R3938:Klkb1 UTSW 8 45282801 missense probably damaging 0.99
R4445:Klkb1 UTSW 8 45277055 missense probably benign 0.11
R4461:Klkb1 UTSW 8 45273575 missense probably damaging 1.00
R4969:Klkb1 UTSW 8 45282777 missense probably benign 0.43
R4974:Klkb1 UTSW 8 45286958 missense probably damaging 1.00
R5113:Klkb1 UTSW 8 45270697 missense probably benign 0.00
R5117:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R5339:Klkb1 UTSW 8 45270711 missense possibly damaging 0.93
R5891:Klkb1 UTSW 8 45270666 missense probably benign 0.13
R6230:Klkb1 UTSW 8 45283215 missense probably benign 0.03
R6554:Klkb1 UTSW 8 45273554 missense probably damaging 1.00
R6564:Klkb1 UTSW 8 45273634 missense probably damaging 0.98
R7130:Klkb1 UTSW 8 45275538 missense not run
Predicted Primers PCR Primer
(F):5'- GACCACATGGGATTCAGTGGACTTG -3'
(R):5'- ATTGCTCAGAAAGCTGGAGGGTCG -3'

Sequencing Primer
(F):5'- GGCCACAGTTCTTAATGCAG -3'
(R):5'- AATTGTATTCACATCCTTCACTCTC -3'
Posted On2013-08-08