Incidental Mutation 'R0352:Ptges'
ID65380
Institutional Source Beutler Lab
Gene Symbol Ptges
Ensembl Gene ENSMUSG00000050737
Gene Nameprostaglandin E synthase
Synonyms2410099E23Rik, D2Ertd369e, mPGES, mPGES-1
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0352 (G1)
Quality Score139
Status Validated
Chromosome2
Chromosomal Location30889471-30929863 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 30903132 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 29 (Y29*)
Ref Sequence ENSEMBL: ENSMUSP00000099916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102852]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056046
SMART Domains Protein: ENSMUSP00000054679
Gene: ENSMUSG00000050737

DomainStartEndE-ValueType
Pfam:MAPEG 13 129 9.6e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102852
AA Change: Y29*
SMART Domains Protein: ENSMUSP00000099916
Gene: ENSMUSG00000050737
AA Change: Y29*

DomainStartEndE-ValueType
Pfam:MAPEG 17 147 1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132244
Meta Mutation Damage Score 0.606 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glutathione-dependent prostaglandin E synthase. The expression of this gene has been shown to be induced by proinflammatory cytokine interleukin 1 beta (IL1B). Its expression can also be induced by tumor suppressor protein TP53, and may be involved in TP53 induced apoptosis. Knockout studies in mice suggest that this gene may contribute to the pathogenesis of collagen-induced arthritis and mediate acute pain during inflammatory responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and display a decreased inflammatory response. Mice homozygous for a conditional allele activated in the vascular smooth muscle, endothelial or myeloid cells exhibit altered response to vascular injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aplf C T 6: 87,653,884 V190I probably benign Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Col11a2 T G 17: 34,042,527 V120G probably benign Het
Cux2 A C 5: 121,884,739 probably benign Het
Dmrt2 T C 19: 25,678,662 S542P probably damaging Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Grm4 C T 17: 27,451,891 probably benign Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Mmrn1 A T 6: 60,944,971 K137N probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Myom1 A G 17: 71,045,749 E356G possibly damaging Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Ptges
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ptges APN 2 30892708 missense probably damaging 1.00
IGL02737:Ptges APN 2 30892686 missense probably damaging 1.00
R2164:Ptges UTSW 2 30892696 missense probably benign 0.31
R2496:Ptges UTSW 2 30892710 missense possibly damaging 0.89
R2497:Ptges UTSW 2 30892710 missense possibly damaging 0.89
R4832:Ptges UTSW 2 30903220 utr 5 prime probably benign
R6703:Ptges UTSW 2 30903121 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGACACCTCTCGCTGTCAAGAGTC -3'
(R):5'- AACAATGGTCCTGAGCCAAGGATG -3'

Sequencing Primer
(F):5'- CTCTCAAACCAAGAGGGTTCAGG -3'
(R):5'- AGCAGAAGTCTCTGGGTTCC -3'
Posted On2013-08-08