Incidental Mutation 'R0352:Grm4'
ID65383
Institutional Source Beutler Lab
Gene Symbol Grm4
Ensembl Gene ENSMUSG00000063239
Gene Nameglutamate receptor, metabotropic 4
SynonymsmGluR4, Gprc1d
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0352 (G1)
Quality Score88
Status Validated
Chromosome17
Chromosomal Location27422387-27521403 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 27451891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]
Predicted Effect probably benign
Transcript: ENSMUST00000118161
SMART Domains Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 1.4e-110 PFAM
Pfam:Peripla_BP_6 144 486 9e-13 PFAM
Pfam:NCD3G 516 566 2.4e-14 PFAM
Pfam:7tm_3 599 844 7.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118489
SMART Domains Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 6.2e-104 PFAM
Pfam:Peripla_BP_6 144 486 8.3e-12 PFAM
Pfam:NCD3G 516 566 5.4e-15 PFAM
Pfam:7tm_3 597 817 1.9e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147865
Predicted Effect probably benign
Transcript: ENSMUST00000231290
Predicted Effect probably benign
Transcript: ENSMUST00000231416
Predicted Effect probably benign
Transcript: ENSMUST00000231809
Predicted Effect probably benign
Transcript: ENSMUST00000232243
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aplf C T 6: 87,653,884 V190I probably benign Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Col11a2 T G 17: 34,042,527 V120G probably benign Het
Cux2 A C 5: 121,884,739 probably benign Het
Dmrt2 T C 19: 25,678,662 S542P probably damaging Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Mmrn1 A T 6: 60,944,971 K137N probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Myom1 A G 17: 71,045,749 E356G possibly damaging Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptges G T 2: 30,903,132 Y29* probably null Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Grm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Grm4 APN 17 27434737 nonsense probably null
IGL02380:Grm4 APN 17 27434661 missense probably damaging 1.00
IGL03244:Grm4 APN 17 27434823 missense probably damaging 0.99
R0013:Grm4 UTSW 17 27431575 missense probably benign 0.01
R0599:Grm4 UTSW 17 27431490 missense probably benign 0.39
R0616:Grm4 UTSW 17 27434564 missense probably damaging 1.00
R0645:Grm4 UTSW 17 27435209 missense probably damaging 1.00
R0726:Grm4 UTSW 17 27438438 splice site probably benign
R1085:Grm4 UTSW 17 27473033 missense probably damaging 1.00
R1486:Grm4 UTSW 17 27434717 missense probably damaging 1.00
R1535:Grm4 UTSW 17 27434801 missense probably benign 0.01
R1799:Grm4 UTSW 17 27472940 missense probably damaging 0.99
R1914:Grm4 UTSW 17 27434712 missense probably damaging 0.99
R2472:Grm4 UTSW 17 27434675 missense probably damaging 1.00
R3759:Grm4 UTSW 17 27435299 missense probably benign 0.00
R4244:Grm4 UTSW 17 27502735 missense probably damaging 1.00
R5390:Grm4 UTSW 17 27434738 missense probably damaging 1.00
R5476:Grm4 UTSW 17 27434798 missense probably benign 0.04
R5516:Grm4 UTSW 17 27438411 missense probably benign 0.06
R5897:Grm4 UTSW 17 27435163 missense probably benign 0.02
R5956:Grm4 UTSW 17 27435155 missense probably benign 0.01
R6391:Grm4 UTSW 17 27435320 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAAGAGACACTTTGGTGACACGGG -3'
(R):5'- CATGTAGACAGGCATAGGCCAAGC -3'

Sequencing Primer
(F):5'- GGCTTCACGCATCCCAG -3'
(R):5'- TGCTGGGTAGCCATACAAGTC -3'
Posted On2013-08-08