Incidental Mutation 'R0389:Crat'
ID65403
Institutional Source Beutler Lab
Gene Symbol Crat
Ensembl Gene ENSMUSG00000026853
Gene Namecarnitine acetyltransferase
SynonymsCARAT
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R0389 (G1)
Quality Score114
Status Not validated
Chromosome2
Chromosomal Location30400471-30415813 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 30403628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000028209] [ENSMUST00000102854] [ENSMUST00000102855] [ENSMUST00000113612] [ENSMUST00000123202] [ENSMUST00000132981] [ENSMUST00000154595] [ENSMUST00000156702]
Predicted Effect probably benign
Transcript: ENSMUST00000028207
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028209
SMART Domains Protein: ENSMUSP00000028209
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
acidPPc 59 180 1.31e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102854
SMART Domains Protein: ENSMUSP00000099918
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 13 595 1.8e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102855
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113612
SMART Domains Protein: ENSMUSP00000109242
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
Pfam:PAP2 58 165 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123202
SMART Domains Protein: ENSMUSP00000119478
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
Pfam:PAP2 1 90 8.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132981
SMART Domains Protein: ENSMUSP00000118507
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 76 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137248
SMART Domains Protein: ENSMUSP00000116276
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 71 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152303
Predicted Effect unknown
Transcript: ENSMUST00000154595
AA Change: Q34R
SMART Domains Protein: ENSMUSP00000114925
Gene: ENSMUSG00000026853
AA Change: Q34R

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 132 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155196
SMART Domains Protein: ENSMUSP00000115602
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 69 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155790
SMART Domains Protein: ENSMUSP00000122814
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 133 2.4e-51 PFAM
Pfam:Carn_acyltransf 128 190 8.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156702
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes carnitine O-acetyltransferase, a member of the carnitine acyltransferase family and a key metabolic pathway enzyme which plays an important role in energy homeostasis and fat metabolism. This enzyme catalyzes the reversible transfer of acyl groups from an acyl-CoA thioester to carnitine and regulates the ratio of acyl-CoA/CoA. It is found in both the mitochondria and the peroxisome. Alternative splicing results in transcript variants encoding different isoforms that may localize to different subcellular compartments. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice with muscle specific loss of function display increased circulating glucose level, impaired glucose tolerance, insulin resistance, decreased circulating triglyceride and free fatty acid levels, increased susceptibility to diet-induced obesity and abnormal mitochondrial physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fasn G T 11: 120,816,182 D881E probably damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hspg2 A G 4: 137,515,423 T650A possibly damaging Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
L3mbtl4 G A 17: 68,455,780 V103M probably damaging Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mbtps2 G T X: 157,568,368 T134K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myh2 T C 11: 67,180,821 L488P probably damaging Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Unc13a A G 8: 71,658,032 F464L probably benign Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in Crat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Crat APN 2 30405187 missense probably damaging 0.99
IGL01357:Crat APN 2 30407724 missense probably damaging 1.00
IGL01538:Crat APN 2 30409966 missense probably damaging 1.00
IGL01973:Crat APN 2 30405481 missense probably damaging 0.98
IGL02228:Crat APN 2 30413182 missense probably damaging 1.00
IGL02408:Crat APN 2 30407134 missense probably damaging 1.00
IGL02569:Crat APN 2 30404530 missense probably damaging 0.99
IGL02637:Crat APN 2 30406389 missense probably benign 0.06
IGL02983:Crat APN 2 30404526 critical splice donor site probably null
IGL03395:Crat APN 2 30404966 missense probably benign 0.11
Charlie UTSW 2 30403541 missense probably damaging 1.00
veruca UTSW 2 30403628 unclassified probably benign
R0136:Crat UTSW 2 30407030 missense probably benign
R0443:Crat UTSW 2 30403628 unclassified probably benign
R0619:Crat UTSW 2 30409984 missense probably benign 0.14
R1938:Crat UTSW 2 30413061 missense probably benign
R1990:Crat UTSW 2 30405048 missense possibly damaging 0.93
R2113:Crat UTSW 2 30402642 missense probably benign 0.00
R2655:Crat UTSW 2 30402691 missense probably damaging 1.00
R3150:Crat UTSW 2 30413859 critical splice donor site probably null
R4231:Crat UTSW 2 30413011 missense possibly damaging 0.95
R4553:Crat UTSW 2 30408217 missense probably benign 0.00
R4592:Crat UTSW 2 30415366 utr 5 prime probably benign
R4718:Crat UTSW 2 30408164 nonsense probably null
R4808:Crat UTSW 2 30410021 missense probably benign 0.01
R4982:Crat UTSW 2 30407136 critical splice acceptor site probably null
R5473:Crat UTSW 2 30407714 missense probably damaging 1.00
R6049:Crat UTSW 2 30403541 missense probably damaging 1.00
R6223:Crat UTSW 2 30407030 missense probably benign 0.07
R6774:Crat UTSW 2 30413183 missense probably damaging 1.00
R6885:Crat UTSW 2 30415196 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGTCACCAGCATCTTGGAGCAC -3'
(R):5'- ACATAGCCTGTATAAGCCCTGCCC -3'

Sequencing Primer
(F):5'- CATCTTGGAGCACCTGAGC -3'
(R):5'- TACACAAGCCCTGATCATGTTG -3'
Posted On2013-08-08