Incidental Mutation 'R0390:Upf2'
ID65411
Institutional Source Beutler Lab
Gene Symbol Upf2
Ensembl Gene ENSMUSG00000043241
Gene NameUPF2 regulator of nonsense transcripts homolog (yeast)
Synonyms
MMRRC Submission 038596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0390 (G1)
Quality Score118
Status Validated
Chromosome2
Chromosomal Location5951469-6056703 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 6018894 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000060092]
Predicted Effect probably benign
Transcript: ENSMUST00000060092
SMART Domains Protein: ENSMUSP00000058375
Gene: ENSMUSG00000043241

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
low complexity region 54 125 N/A INTRINSIC
MIF4G 167 363 1.22e-32 SMART
coiled coil region 514 543 N/A INTRINSIC
MIF4G 567 756 1.13e-50 SMART
MIF4G 771 984 3.43e-50 SMART
low complexity region 1023 1042 N/A INTRINSIC
Pfam:Upf2 1051 1215 1.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128200
SMART Domains Protein: ENSMUSP00000119348
Gene: ENSMUSG00000043241

DomainStartEndE-ValueType
MIF4G 27 240 3.43e-50 SMART
low complexity region 279 298 N/A INTRINSIC
Pfam:Upf2 304 469 3.1e-44 PFAM
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Upf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Upf2 APN 2 5961300 missense unknown
IGL01394:Upf2 APN 2 6040213 splice site probably null
IGL01571:Upf2 APN 2 6018939 unclassified probably benign
IGL01624:Upf2 APN 2 6034179 missense probably benign
IGL02121:Upf2 APN 2 6026323 splice site probably benign
IGL02485:Upf2 APN 2 6027291 missense unknown
IGL02491:Upf2 APN 2 6026164 missense unknown
R0265:Upf2 UTSW 2 6027204 splice site probably benign
R0480:Upf2 UTSW 2 5957634 missense possibly damaging 0.71
R0513:Upf2 UTSW 2 5957667 missense unknown
R0579:Upf2 UTSW 2 5988429 missense unknown
R0612:Upf2 UTSW 2 6034098 splice site probably benign
R0856:Upf2 UTSW 2 5957652 missense unknown
R1103:Upf2 UTSW 2 6026175 missense unknown
R1384:Upf2 UTSW 2 5960989 missense unknown
R1672:Upf2 UTSW 2 6040097 splice site probably null
R1728:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1784:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1836:Upf2 UTSW 2 6050324 splice site probably null
R2252:Upf2 UTSW 2 5961460 missense unknown
R2339:Upf2 UTSW 2 6040102 splice site probably benign
R3015:Upf2 UTSW 2 5976079 missense unknown
R3931:Upf2 UTSW 2 6047010 missense unknown
R4151:Upf2 UTSW 2 5961705 missense unknown
R4283:Upf2 UTSW 2 5973558 missense unknown
R4558:Upf2 UTSW 2 5973593 missense unknown
R4564:Upf2 UTSW 2 6027312 missense unknown
R5630:Upf2 UTSW 2 6027301 missense probably damaging 0.99
R6370:Upf2 UTSW 2 5976010 missense unknown
R6418:Upf2 UTSW 2 6027339 missense unknown
R6432:Upf2 UTSW 2 5979777 missense unknown
R7184:Upf2 UTSW 2 6023320 missense unknown
R7308:Upf2 UTSW 2 5973518 missense unknown
R7371:Upf2 UTSW 2 5961040 missense unknown
R7404:Upf2 UTSW 2 6040203 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTGTTGCTGTTAGGTAGGGACCATAA -3'
(R):5'- TCCTTGAAGGGAATCAAGACCCTCAT -3'

Sequencing Primer
(F):5'- CTGTTAGGTAGGGACCATAATAAGC -3'
(R):5'- GGGAATCAAGACCCTCATCTTTTTAC -3'
Posted On2013-08-08