Incidental Mutation 'R0391:March1'
ID65417
Institutional Source Beutler Lab
Gene Symbol March1
Ensembl Gene ENSMUSG00000036469
Gene Namemembrane-associated ring finger (C3HC4) 1
Synonyms
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0391 (G1)
Quality Score145
Status Validated
Chromosome8
Chromosomal Location65617900-66471637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66418973 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 385 (T385A)
Ref Sequence ENSEMBL: ENSMUSP00000105885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039540
AA Change: T124A

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469
AA Change: T124A

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072482
AA Change: T130A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469
AA Change: T130A

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098708
AA Change: T134A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469
AA Change: T134A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
AA Change: T124A

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469
AA Change: T124A

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110255
AA Change: T134A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469
AA Change: T134A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110256
AA Change: T385A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: T385A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110258
AA Change: T134A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469
AA Change: T134A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110259
AA Change: T130A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469
AA Change: T130A

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably damaging
Transcript: ENSMUST00000178982
AA Change: T134A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469
AA Change: T134A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in March1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:March1 APN 8 66418877 missense possibly damaging 0.88
IGL02468:March1 APN 8 66418911 missense probably damaging 1.00
R1500:March1 UTSW 8 66468390 missense probably damaging 1.00
R1794:March1 UTSW 8 66386942 missense possibly damaging 0.63
R2015:March1 UTSW 8 66121821 missense probably damaging 0.99
R2184:March1 UTSW 8 66387423 missense probably benign 0.07
R2273:March1 UTSW 8 66387499 missense probably benign 0.15
R2274:March1 UTSW 8 66387499 missense probably benign 0.15
R2275:March1 UTSW 8 66387499 missense probably benign 0.15
R2314:March1 UTSW 8 66121790 start codon destroyed probably null 0.77
R3114:March1 UTSW 8 66387381 missense probably benign
R4458:March1 UTSW 8 66456171 missense probably damaging 1.00
R4656:March1 UTSW 8 66386419 missense probably benign 0.05
R4773:March1 UTSW 8 66387224 missense probably benign 0.03
R4838:March1 UTSW 8 66468363 missense probably damaging 1.00
R5073:March1 UTSW 8 66386368 missense probably benign 0.03
R5507:March1 UTSW 8 66418890 missense probably damaging 1.00
R5575:March1 UTSW 8 66468310 missense probably damaging 1.00
R5916:March1 UTSW 8 66387111 missense possibly damaging 0.89
R6931:March1 UTSW 8 66468492 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGCCCTATGCAAAGGCAGAC -3'
(R):5'- GAACGCACACAATGCGAGTCAG -3'

Sequencing Primer
(F):5'- TGCCATATCCTCTGGGAGAAC -3'
(R):5'- GAGTCAGAACAAACTGATTTACCTGC -3'
Posted On2013-08-08