Incidental Mutation 'R0384:Npr1'
ID65486
Institutional Source Beutler Lab
Gene Symbol Npr1
Ensembl Gene ENSMUSG00000027931
Gene Namenatriuretic peptide receptor 1
SynonymsNPRA, guanylyl cyclase-A, GC-A, NPR-A
MMRRC Submission 038590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0384 (G1)
Quality Score141
Status Validated
Chromosome3
Chromosomal Location90450591-90465866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90465167 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 113 (G113C)
Ref Sequence ENSEMBL: ENSMUSP00000029540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029540]
Predicted Effect probably damaging
Transcript: ENSMUST00000029540
AA Change: G113C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029540
Gene: ENSMUSG00000027931
AA Change: G113C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 50 410 4.7e-54 PFAM
low complexity region 468 488 N/A INTRINSIC
Pfam:Pkinase_Tyr 538 797 1.2e-39 PFAM
Pfam:Pkinase 543 796 8.7e-31 PFAM
CYCc 836 1030 5.04e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124760
SMART Domains Protein: ENSMUSP00000118023
Gene: ENSMUSG00000027931

DomainStartEndE-ValueType
PDB:3A3K|B 2 20 1e-8 PDB
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196464
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides; they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2; MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous inactivation of this gene can lead to hypertension, cardiac hypertrophy, lethal vascular events, congestive heart failure in response to volume overload, reduced serum testosterone levels, altered steroidogenesis, and reduced myocardial PMN infiltration and infarct size after I/R injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,986,812 probably benign Het
Akr1b8 T C 6: 34,364,330 probably benign Het
Arhgef39 A G 4: 43,498,613 L117P probably damaging Het
Atp13a1 A T 8: 69,797,324 Q356L possibly damaging Het
Bmp2k T A 5: 97,031,125 probably benign Het
Ccdc141 A G 2: 77,027,648 V1063A probably damaging Het
Col20a1 T C 2: 180,999,162 Y568H probably benign Het
Crabp2 T C 3: 87,953,021 V134A possibly damaging Het
Cyp19a1 T C 9: 54,172,741 K265E probably benign Het
Cyp2j9 T C 4: 96,585,885 H106R probably benign Het
Dcps T C 9: 35,175,943 K9R probably damaging Het
Dnajc6 C T 4: 101,598,956 T47I probably damaging Het
Dnhd1 T G 7: 105,720,114 S4315A possibly damaging Het
Dnmt3l A T 10: 78,052,737 I158F possibly damaging Het
Dock3 A G 9: 106,901,895 probably benign Het
Eefsec A G 6: 88,281,650 probably null Het
Fam204a T C 19: 60,221,296 M1V probably null Het
Fam98b T C 2: 117,267,847 V266A possibly damaging Het
Fat2 A T 11: 55,269,465 I3274N possibly damaging Het
Fbxo18 A G 2: 11,749,578 I198T probably damaging Het
Fer T C 17: 63,924,184 probably benign Het
Fhad1 T A 4: 142,002,426 M89L probably benign Het
Fjx1 C A 2: 102,451,107 C161F probably damaging Het
Fkbp7 T A 2: 76,665,824 probably benign Het
Gm42669 T A 5: 107,508,798 C976S probably benign Het
Gm4845 T C 1: 141,257,085 noncoding transcript Het
Herc1 T A 9: 66,481,050 probably benign Het
Hook3 C T 8: 26,044,235 probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Itga2b A T 11: 102,465,362 probably null Het
Klk1b21 T C 7: 44,105,493 Y71H probably benign Het
Kndc1 A T 7: 139,910,599 N339I possibly damaging Het
Ky C T 9: 102,542,090 T432I probably benign Het
Map4 C T 9: 110,034,628 T307I probably damaging Het
Matn1 T C 4: 130,944,476 L18P probably benign Het
Mindy4 G A 6: 55,216,684 D121N probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Msto1 G A 3: 88,910,339 Q441* probably null Het
Muc5ac A G 7: 141,812,251 H2048R possibly damaging Het
Musk T C 4: 58,373,711 *879Q probably null Het
Nat8f2 T C 6: 85,868,368 Y4C possibly damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Nid1 A G 13: 13,463,836 T114A probably benign Het
Nrxn1 G A 17: 90,208,347 P193S probably damaging Het
Nwd2 T C 5: 63,805,682 F870L probably benign Het
Olfr1076 T A 2: 86,509,383 I308K possibly damaging Het
Olfr1228 A G 2: 89,249,070 I208T possibly damaging Het
Olfr55 A G 17: 33,176,548 I45V probably damaging Het
Olfr787 T A 10: 129,463,040 Y121* probably null Het
Phf14 A G 6: 11,997,020 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm2 T C 4: 143,135,688 E344G probably benign Het
Psmd12 T C 11: 107,485,721 V61A probably benign Het
Relt T C 7: 100,847,505 D385G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scg2 T A 1: 79,435,549 I446F probably benign Het
Sema3b G A 9: 107,600,966 L407F probably damaging Het
Slc25a13 A T 6: 6,042,600 Y601* probably null Het
Sun5 C T 2: 153,858,965 V270I probably benign Het
Tex52 A G 6: 128,379,533 Y63C probably damaging Het
Tmem138 A G 19: 10,574,822 probably benign Het
Tnpo3 A G 6: 29,582,164 probably null Het
Tspoap1 A T 11: 87,766,454 Q364L probably damaging Het
Ttc41 T C 10: 86,763,947 L1037P probably damaging Het
Ugcg T A 4: 59,220,387 D393E possibly damaging Het
Vmn1r184 T C 7: 26,267,651 I274T probably benign Het
Vmn2r27 A G 6: 124,223,912 V362A probably benign Het
Vmn2r87 T A 10: 130,471,843 Y842F probably benign Het
Vps8 T A 16: 21,506,825 probably benign Het
Other mutations in Npr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Npr1 APN 3 90458362 missense probably damaging 1.00
IGL01432:Npr1 APN 3 90463236 missense possibly damaging 0.85
IGL02106:Npr1 APN 3 90464858 missense probably benign 0.12
IGL03310:Npr1 APN 3 90455991 missense probably benign 0.30
PIT4581001:Npr1 UTSW 3 90462257 missense probably damaging 1.00
R0010:Npr1 UTSW 3 90454832 missense probably damaging 1.00
R0137:Npr1 UTSW 3 90455937 missense probably damaging 1.00
R0656:Npr1 UTSW 3 90461369 missense probably benign
R0941:Npr1 UTSW 3 90461409 missense probably benign
R0961:Npr1 UTSW 3 90458721 missense possibly damaging 0.91
R1172:Npr1 UTSW 3 90461382 missense probably benign 0.01
R1747:Npr1 UTSW 3 90458669 missense possibly damaging 0.88
R1763:Npr1 UTSW 3 90459337 missense probably damaging 0.98
R1900:Npr1 UTSW 3 90462188 missense probably damaging 0.98
R3807:Npr1 UTSW 3 90458726 missense probably damaging 0.98
R4017:Npr1 UTSW 3 90456232 missense probably damaging 1.00
R4437:Npr1 UTSW 3 90456286 missense probably damaging 1.00
R4900:Npr1 UTSW 3 90455965 missense possibly damaging 0.77
R5265:Npr1 UTSW 3 90457002 missense probably benign 0.29
R5343:Npr1 UTSW 3 90458208 missense possibly damaging 0.94
R5590:Npr1 UTSW 3 90454842 missense probably damaging 0.99
R5868:Npr1 UTSW 3 90459493 intron probably benign
R6782:Npr1 UTSW 3 90456253 missense probably benign 0.18
R6828:Npr1 UTSW 3 90464813 missense probably benign
R6903:Npr1 UTSW 3 90455145 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCAGCCGATCTGCATAGAGCAC -3'
(R):5'- ACACCTCGTACCCGTGGTCTTG -3'

Sequencing Primer
(F):5'- TCTGCATAGAGCACAAGCG -3'
(R):5'- TGGAACTGGCTCTCGGG -3'
Posted On2013-08-08