Incidental Mutation 'R0384:Tnpo3'
ID65488
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Nametransportin 3
SynonymsD6Ertd313e, 5730544L10Rik, C430013M08Rik
MMRRC Submission 038590-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0384 (G1)
Quality Score109
Status Validated
Chromosome6
Chromosomal Location29540827-29609887 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 29582164 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000115251] [ENSMUST00000170350]
Predicted Effect probably null
Transcript: ENSMUST00000012679
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115251
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115251
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169302
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170634
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,986,812 probably benign Het
Akr1b8 T C 6: 34,364,330 probably benign Het
Arhgef39 A G 4: 43,498,613 L117P probably damaging Het
Atp13a1 A T 8: 69,797,324 Q356L possibly damaging Het
Bmp2k T A 5: 97,031,125 probably benign Het
Ccdc141 A G 2: 77,027,648 V1063A probably damaging Het
Col20a1 T C 2: 180,999,162 Y568H probably benign Het
Crabp2 T C 3: 87,953,021 V134A possibly damaging Het
Cyp19a1 T C 9: 54,172,741 K265E probably benign Het
Cyp2j9 T C 4: 96,585,885 H106R probably benign Het
Dcps T C 9: 35,175,943 K9R probably damaging Het
Dnajc6 C T 4: 101,598,956 T47I probably damaging Het
Dnhd1 T G 7: 105,720,114 S4315A possibly damaging Het
Dnmt3l A T 10: 78,052,737 I158F possibly damaging Het
Dock3 A G 9: 106,901,895 probably benign Het
Eefsec A G 6: 88,281,650 probably null Het
Fam204a T C 19: 60,221,296 M1V probably null Het
Fam98b T C 2: 117,267,847 V266A possibly damaging Het
Fat2 A T 11: 55,269,465 I3274N possibly damaging Het
Fbxo18 A G 2: 11,749,578 I198T probably damaging Het
Fer T C 17: 63,924,184 probably benign Het
Fhad1 T A 4: 142,002,426 M89L probably benign Het
Fjx1 C A 2: 102,451,107 C161F probably damaging Het
Fkbp7 T A 2: 76,665,824 probably benign Het
Gm42669 T A 5: 107,508,798 C976S probably benign Het
Gm4845 T C 1: 141,257,085 noncoding transcript Het
Herc1 T A 9: 66,481,050 probably benign Het
Hook3 C T 8: 26,044,235 probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Itga2b A T 11: 102,465,362 probably null Het
Klk1b21 T C 7: 44,105,493 Y71H probably benign Het
Kndc1 A T 7: 139,910,599 N339I possibly damaging Het
Ky C T 9: 102,542,090 T432I probably benign Het
Map4 C T 9: 110,034,628 T307I probably damaging Het
Matn1 T C 4: 130,944,476 L18P probably benign Het
Mindy4 G A 6: 55,216,684 D121N probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Msto1 G A 3: 88,910,339 Q441* probably null Het
Muc5ac A G 7: 141,812,251 H2048R possibly damaging Het
Musk T C 4: 58,373,711 *879Q probably null Het
Nat8f2 T C 6: 85,868,368 Y4C possibly damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Nid1 A G 13: 13,463,836 T114A probably benign Het
Npr1 C A 3: 90,465,167 G113C probably damaging Het
Nrxn1 G A 17: 90,208,347 P193S probably damaging Het
Nwd2 T C 5: 63,805,682 F870L probably benign Het
Olfr1076 T A 2: 86,509,383 I308K possibly damaging Het
Olfr1228 A G 2: 89,249,070 I208T possibly damaging Het
Olfr55 A G 17: 33,176,548 I45V probably damaging Het
Olfr787 T A 10: 129,463,040 Y121* probably null Het
Phf14 A G 6: 11,997,020 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm2 T C 4: 143,135,688 E344G probably benign Het
Psmd12 T C 11: 107,485,721 V61A probably benign Het
Relt T C 7: 100,847,505 D385G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scg2 T A 1: 79,435,549 I446F probably benign Het
Sema3b G A 9: 107,600,966 L407F probably damaging Het
Slc25a13 A T 6: 6,042,600 Y601* probably null Het
Sun5 C T 2: 153,858,965 V270I probably benign Het
Tex52 A G 6: 128,379,533 Y63C probably damaging Het
Tmem138 A G 19: 10,574,822 probably benign Het
Tspoap1 A T 11: 87,766,454 Q364L probably damaging Het
Ttc41 T C 10: 86,763,947 L1037P probably damaging Het
Ugcg T A 4: 59,220,387 D393E possibly damaging Het
Vmn1r184 T C 7: 26,267,651 I274T probably benign Het
Vmn2r27 A G 6: 124,223,912 V362A probably benign Het
Vmn2r87 T A 10: 130,471,843 Y842F probably benign Het
Vps8 T A 16: 21,506,825 probably benign Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29578461 critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29565846 nonsense probably null
IGL00753:Tnpo3 APN 6 29565787 missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29589048 missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29586078 missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29575020 missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29589020 splice site probably benign
IGL01987:Tnpo3 APN 6 29560201 missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29609451 missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29562900 nonsense probably null
IGL03409:Tnpo3 APN 6 29555182 missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29555222 missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29568922 missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29565652 splice site probably benign
R0597:Tnpo3 UTSW 6 29578565 nonsense probably null
R0710:Tnpo3 UTSW 6 29586075 missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29554993 splice site probably benign
R1494:Tnpo3 UTSW 6 29557044 missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29560221 missense possibly damaging 0.70
R1663:Tnpo3 UTSW 6 29565759 missense probably benign 0.04
R1816:Tnpo3 UTSW 6 29557017 missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29586144 missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29551872 missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29589036 missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29579619 missense probably benign 0.19
R3765:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R3766:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R4125:Tnpo3 UTSW 6 29560092 missense probably damaging 1.00
R4525:Tnpo3 UTSW 6 29561398 missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29578542 missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29568938 missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29582260 missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29582153 splice site probably benign
R5325:Tnpo3 UTSW 6 29602013 intron probably benign
R5512:Tnpo3 UTSW 6 29575046 missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29565198 nonsense probably null
R5689:Tnpo3 UTSW 6 29571064 missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29589033 missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29588043 nonsense probably null
R6105:Tnpo3 UTSW 6 29588043 nonsense probably null
R6137:Tnpo3 UTSW 6 29555268 missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29571101 missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29572703 splice site probably null
R6569:Tnpo3 UTSW 6 29571066 missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29572595 nonsense probably null
R7006:Tnpo3 UTSW 6 29589163 missense probably damaging 1.00
R7312:Tnpo3 UTSW 6 29562876 missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29556996 missense probably damaging 1.00
Z1088:Tnpo3 UTSW 6 29565843 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCATAGAACTGAGAGCGCCTGTAA -3'
(R):5'- CACAAAGGCTCAGATAAAGGCAGTGA -3'

Sequencing Primer
(F):5'- gtgccaacaaaagccaaaag -3'
(R):5'- TCAGATAAAGGCAGTGAGTGGC -3'
Posted On2013-08-08