Mutagenetix > Incidental Mutation

Incidental Mutation 'R0369:Adamts16'

65595

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 16

Synonyms

MMRRC Submission

038575-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0369 (G1)

Quality Score

147

Status

Not validated

Chromosome

Chromosomal Location

70875921-70989930 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 70927671 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 523 (K523Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080145
AA Change: K523Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: K523Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109694
AA Change: K523Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: K523Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	2.2e-32	PFAM
Pfam:Reprolysin_5	287	470	1.8e-13	PFAM
Pfam:Reprolysin_4	289	489	7.3e-9	PFAM
Pfam:Reprolysin	289	493	4.6e-33	PFAM
Pfam:Reprolysin_2	306	483	4.1e-10	PFAM
Pfam:Reprolysin_3	310	442	3.3e-10	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123552
AA Change: K523Q

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538
AA Change: K523Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.8%
20x: 87.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	G	A	9: 114,129,077 (GRCm39)		noncoding transcript	Het
Aadacl2	T	A	3: 59,932,143 (GRCm39)	Y219*	probably null	Het
Adamts13	C	A	2: 26,895,198 (GRCm39)	D1096E	probably benign	Het
Adcy2	A	G	13: 68,820,019 (GRCm39)	F740S	probably benign	Het
Carmil1	T	A	13: 24,266,003 (GRCm39)	N253I	probably damaging	Het
Ccdc97	T	C	7: 25,413,833 (GRCm39)	T283A	probably damaging	Het
Cmpk2	G	T	12: 26,527,150 (GRCm39)	E380*	probably null	Het
Csmd3	A	G	15: 47,833,543 (GRCm39)	I911T	probably damaging	Het
Cyp2c39	T	C	19: 39,502,079 (GRCm39)	L156P	probably damaging	Het
D7Ertd443e	T	C	7: 133,899,866 (GRCm39)	I499V	possibly damaging	Het
Dhx58	A	C	11: 100,592,374 (GRCm39)		probably null	Het
Dip2a	C	T	10: 76,134,621 (GRCm39)	G390S	probably damaging	Het
Dusp10	A	G	1: 183,801,253 (GRCm39)	D340G	probably damaging	Het
Epha1	A	T	6: 42,342,407 (GRCm39)	C314S	probably damaging	Het
Exph5	A	T	9: 53,284,602 (GRCm39)	H561L	probably benign	Het
Fbxw26	A	G	9: 109,552,780 (GRCm39)		probably null	Het
Foxc1	A	C	13: 31,991,495 (GRCm39)	N102T	probably damaging	Het
Fsip2	T	C	2: 82,814,908 (GRCm39)	I3547T	probably benign	Het
Gm5464	G	T	14: 67,106,774 (GRCm39)		probably benign	Het
Gnptab	C	T	10: 88,269,456 (GRCm39)	R720C	possibly damaging	Het
Greb1l	T	C	18: 10,469,375 (GRCm39)	V130A	possibly damaging	Het
Hmg20a	A	T	9: 56,394,934 (GRCm39)	D216V	probably damaging	Het
Hnrnpul2	C	A	19: 8,801,777 (GRCm39)	D328E	probably damaging	Het
Hsh2d	G	A	8: 72,954,304 (GRCm39)	D229N	probably benign	Het
Ift172	T	C	5: 31,410,985 (GRCm39)	Y1691C	probably damaging	Het
Kremen2	T	C	17: 23,961,784 (GRCm39)	D241G	probably benign	Het
Meis2	T	C	2: 115,893,897 (GRCm39)	D5G	possibly damaging	Het
Mrps5	G	A	2: 127,433,749 (GRCm39)	R46K	probably benign	Het
Myh14	C	T	7: 44,310,374 (GRCm39)	V170M	probably damaging	Het
Nexn	T	C	3: 151,953,894 (GRCm39)	N123D	probably benign	Het
Or11g26	T	A	14: 50,753,282 (GRCm39)	M207K	probably benign	Het
Or4d11	A	T	19: 12,013,765 (GRCm39)	S114T	probably benign	Het
Or51l14	T	A	7: 103,101,423 (GRCm39)	I293N	probably damaging	Het
Pacs1	C	T	19: 5,191,726 (GRCm39)	V704M	probably damaging	Het
Papolg	A	G	11: 23,822,425 (GRCm39)		probably null	Het
Pdlim3	T	C	8: 46,370,543 (GRCm39)	V281A	probably benign	Het
Plpp4	T	G	7: 128,925,190 (GRCm39)	F142V	probably damaging	Het
Prb1a	G	A	6: 132,184,620 (GRCm39)	Q338*	probably null	Het
Psg26	G	T	7: 18,216,481 (GRCm39)	Y119*	probably null	Het
Ptger4	A	G	15: 5,272,491 (GRCm39)	C68R	probably benign	Het
Ptpre	T	A	7: 135,272,444 (GRCm39)	I399N	probably damaging	Het
Ripply2	A	G	9: 86,898,372 (GRCm39)	Y72C	probably damaging	Het
Rp1l1	T	A	14: 64,266,837 (GRCm39)	S808T	possibly damaging	Het
Scn5a	G	A	9: 119,362,838 (GRCm39)	T594I	probably damaging	Het
Sf3b1	T	C	1: 55,037,267 (GRCm39)	D883G	probably benign	Het
Skint5	A	T	4: 113,369,220 (GRCm39)		probably null	Het
Terf1	A	G	1: 15,889,207 (GRCm39)	H212R	probably damaging	Het
Tmco5	T	G	2: 116,711,269 (GRCm39)		probably null	Het
Tnfaip3	A	T	10: 18,882,660 (GRCm39)	Y252*	probably null	Het
Tnrc6a	T	A	7: 122,770,083 (GRCm39)	N624K	probably damaging	Het
Top3a	C	A	11: 60,633,615 (GRCm39)	R827L	probably damaging	Het
Unc79	G	A	12: 103,055,031 (GRCm39)		probably null	Het
Usp20	T	C	2: 30,901,116 (GRCm39)	S422P	probably benign	Het
Utrn	T	C	10: 12,509,766 (GRCm39)	E2402G	probably benign	Het
Wdr3	G	A	3: 100,063,734 (GRCm39)	Q181*	probably null	Het
Zfp536	T	C	7: 37,267,373 (GRCm39)	E681G	probably damaging	Het
Zfp91	C	T	19: 12,747,438 (GRCm39)	V562I	possibly damaging	Het
Zfp942	A	T	17: 22,148,017 (GRCm39)	I204N	probably benign	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70,943,603 (GRCm39)	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70,984,234 (GRCm39)	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70,941,260 (GRCm39)	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70,949,080 (GRCm39)	nonsense	probably null
IGL01874:Adamts16	APN	13	70,916,823 (GRCm39)	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70,935,266 (GRCm39)	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70,921,048 (GRCm39)	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70,935,289 (GRCm39)	splice site	probably benign
IGL02450:Adamts16	APN	13	70,984,419 (GRCm39)	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70,886,897 (GRCm39)	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70,901,410 (GRCm39)	missense	probably benign	0.00
swap	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
switcheroo	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70,927,763 (GRCm39)	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70,927,730 (GRCm39)	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably benign
R0422:Adamts16	UTSW	13	70,887,074 (GRCm39)	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70,916,766 (GRCm39)	missense	probably benign
R0524:Adamts16	UTSW	13	70,949,013 (GRCm39)	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0734:Adamts16	UTSW	13	70,886,600 (GRCm39)	splice site	probably benign
R0787:Adamts16	UTSW	13	70,886,948 (GRCm39)	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70,916,811 (GRCm39)	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70,911,680 (GRCm39)	splice site	probably benign
R1027:Adamts16	UTSW	13	70,915,921 (GRCm39)	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70,946,154 (GRCm39)	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70,927,717 (GRCm39)	splice site	probably null
R1869:Adamts16	UTSW	13	70,883,866 (GRCm39)	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70,940,005 (GRCm39)	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70,901,386 (GRCm39)	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70,949,126 (GRCm39)	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70,887,010 (GRCm39)	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70,916,111 (GRCm39)	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70,927,743 (GRCm39)	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70,901,315 (GRCm39)	nonsense	probably null
R5464:Adamts16	UTSW	13	70,909,868 (GRCm39)	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70,878,253 (GRCm39)	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70,984,494 (GRCm39)	nonsense	probably null
R5735:Adamts16	UTSW	13	70,984,337 (GRCm39)	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70,886,617 (GRCm39)	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70,877,029 (GRCm39)	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70,918,393 (GRCm39)	nonsense	probably null
R6351:Adamts16	UTSW	13	70,984,322 (GRCm39)	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70,927,689 (GRCm39)	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70,877,017 (GRCm39)	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70,916,639 (GRCm39)	splice site	probably null
R6996:Adamts16	UTSW	13	70,946,157 (GRCm39)	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70,921,074 (GRCm39)	nonsense	probably null
R7356:Adamts16	UTSW	13	70,984,399 (GRCm39)	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70,935,283 (GRCm39)	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70,878,234 (GRCm39)	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70,984,265 (GRCm39)	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70,886,701 (GRCm39)	missense	probably benign
R8231:Adamts16	UTSW	13	70,925,599 (GRCm39)	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70,941,217 (GRCm39)	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70,984,496 (GRCm39)	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70,886,794 (GRCm39)	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70,984,453 (GRCm39)	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70,941,307 (GRCm39)	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70,939,910 (GRCm39)	splice site	probably benign
R8973:Adamts16	UTSW	13	70,886,959 (GRCm39)	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70,883,948 (GRCm39)	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70,949,045 (GRCm39)	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70,949,136 (GRCm39)	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70,909,892 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAAAAGTATCTCCCATCATCTGCTCCG -3'
(R):5'- GGAAACCCTCACGTTAGACATCTGC -3'

Sequencing Primer
(F):5'- TCCTGTTACATTGGGccagtc -3'
(R):5'- TCTGTCATCAAATTGCATGGG -3'

Posted On

2013-08-08