Incidental Mutation 'R0376:Ints14'
ID65636
Institutional Source Beutler Lab
Gene Symbol Ints14
Ensembl Gene ENSMUSG00000034263
Gene Nameintegrator complex subunit 14
SynonymsVwa9, 2010321M09Rik
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R0376 (G1)
Quality Score155
Status Validated
Chromosome9
Chromosomal Location64960905-64986978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64983990 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 418 (K418E)
Ref Sequence ENSEMBL: ENSMUSP00000127420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036615] [ENSMUST00000037504] [ENSMUST00000170517]
Predicted Effect probably benign
Transcript: ENSMUST00000036615
SMART Domains Protein: ENSMUSP00000044955
Gene: ENSMUSG00000033629

DomainStartEndE-ValueType
Pfam:CS 8 84 2.3e-7 PFAM
low complexity region 119 136 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
Pfam:PTPLA 195 356 1.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000037504
AA Change: K418E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049284
Gene: ENSMUSG00000034263
AA Change: K418E

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170517
AA Change: K418E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127420
Gene: ENSMUSG00000034263
AA Change: K418E

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Ints14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Ints14 APN 9 64972792 missense probably benign 0.30
R0589:Ints14 UTSW 9 64979831 missense probably damaging 1.00
R0614:Ints14 UTSW 9 64964433 missense probably benign
R0708:Ints14 UTSW 9 64983984 missense probably benign 0.29
R1192:Ints14 UTSW 9 64966763 missense possibly damaging 0.86
R2114:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2115:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2117:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2484:Ints14 UTSW 9 64986084 missense probably benign
R4811:Ints14 UTSW 9 64964518 missense probably damaging 1.00
R4953:Ints14 UTSW 9 64982058 missense probably damaging 1.00
R5067:Ints14 UTSW 9 64964412 missense probably damaging 1.00
R6080:Ints14 UTSW 9 64966762 missense probably benign 0.02
R6326:Ints14 UTSW 9 64964437 missense probably benign 0.08
R6395:Ints14 UTSW 9 64978124 splice site probably null
R7036:Ints14 UTSW 9 64964545 missense probably benign
R7147:Ints14 UTSW 9 64983985 missense possibly damaging 0.93
R7203:Ints14 UTSW 9 64964419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTGAAAGCGTCTCAGGAGTC -3'
(R):5'- TTGCAGAGCACATCCATTCCCTTAC -3'

Sequencing Primer
(F):5'- CTCCATGCTGACACGAAGTTTG -3'
(R):5'- CACAGGACTGTGTCATTTAGGC -3'
Posted On2013-08-08