Incidental Mutation 'R0363:Plekha5'
ID65705
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 038569-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R0363 (G1)
Quality Score176
Status Validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140591747 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 646 (R646K)
Ref Sequence ENSEMBL: ENSMUSP00000144973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203012] [ENSMUST00000203483] [ENSMUST00000204080] [ENSMUST00000204145] [ENSMUST00000205026] [ENSMUST00000213444]
Predicted Effect probably benign
Transcript: ENSMUST00000087622
AA Change: R1233K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: R1233K

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203012
AA Change: R754K

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145499
Gene: ENSMUSG00000030231
AA Change: R754K

DomainStartEndE-ValueType
Blast:PH 210 250 2e-8 BLAST
coiled coil region 268 302 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 727 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203483
AA Change: R288K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145219
Gene: ENSMUSG00000030231
AA Change: R288K

DomainStartEndE-ValueType
low complexity region 261 279 N/A INTRINSIC
low complexity region 298 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204080
SMART Domains Protein: ENSMUSP00000144872
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
Blast:PH 220 260 1e-8 BLAST
coiled coil region 278 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204145
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000205026
AA Change: R646K

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144973
Gene: ENSMUSG00000030231
AA Change: R646K

DomainStartEndE-ValueType
Blast:PH 165 205 1e-8 BLAST
coiled coil region 223 257 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205255
Predicted Effect probably benign
Transcript: ENSMUST00000213444
AA Change: R560K

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.5%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik T A 4: 109,524,323 Q86L probably null Het
5430403G16Rik T C 5: 109,676,888 E232G probably benign Het
Abhd2 A G 7: 79,350,813 D262G possibly damaging Het
Abhd5 T C 9: 122,368,146 F133L possibly damaging Het
Agap2 T A 10: 127,090,965 V957E probably damaging Het
Ankrd12 T C 17: 65,985,681 K919R probably damaging Het
Ap1m1 T C 8: 72,256,724 probably benign Het
Ap1m1 T C 8: 72,252,894 S245P probably benign Het
Apcdd1 A G 18: 62,937,097 Y145C possibly damaging Het
Apob A T 12: 8,010,136 N2840Y probably damaging Het
Arel1 A G 12: 84,934,253 S327P probably damaging Het
Arhgap21 C A 2: 20,881,133 R421L probably damaging Het
Ccdc85a A T 11: 28,583,400 I48N probably damaging Het
Chd6 A G 2: 161,014,324 S672P probably damaging Het
Ciz1 G C 2: 32,377,363 probably null Het
Cmbl G A 15: 31,585,442 probably null Het
Cmya5 A G 13: 93,094,869 V1237A possibly damaging Het
Cntnap4 A T 8: 112,856,511 K1074* probably null Het
Cntnap5b A G 1: 100,274,468 M347V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cuzd1 A T 7: 131,316,262 M203K probably benign Het
Cyp3a16 T C 5: 145,455,879 probably benign Het
Dlgap3 A G 4: 127,235,521 E892G probably damaging Het
Dnah7b T C 1: 46,236,788 S2612P probably damaging Het
Epas1 T G 17: 86,805,848 probably benign Het
Etv5 G A 16: 22,411,708 A192V probably benign Het
Fa2h T A 8: 111,349,289 H234L probably damaging Het
Fcho1 T C 8: 71,717,490 Y47C probably damaging Het
Flvcr1 T A 1: 191,012,254 probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b T C 8: 81,884,257 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kmt2a A G 9: 44,809,713 probably null Het
Krt4 G A 15: 101,924,646 R9C possibly damaging Het
Map1a T C 2: 121,302,044 S876P probably damaging Het
Mettl21e A G 1: 44,211,030 probably null Het
Msh2 C T 17: 87,717,476 T594M probably benign Het
Mtmr3 A G 11: 4,487,536 S973P probably damaging Het
Muc5ac A T 7: 141,800,960 M889L probably benign Het
Ntn1 A G 11: 68,385,543 I193T probably benign Het
Nudt13 A T 14: 20,309,783 I193F probably damaging Het
Olfr1272 A T 2: 90,281,856 S240T probably damaging Het
Olfr134 A G 17: 38,175,447 D121G probably damaging Het
Olfr410 C T 11: 74,335,099 G44D probably damaging Het
Olfr498 A T 7: 108,465,734 T137S possibly damaging Het
Otulin A G 15: 27,606,295 V344A probably damaging Het
P2rx7 C T 5: 122,657,030 Q128* probably null Het
Pcdhb22 G A 18: 37,519,160 R227H probably benign Het
Pltp C T 2: 164,840,136 R394H probably benign Het
Ppip5k1 C G 2: 121,347,355 A324P probably damaging Het
Pramef17 C T 4: 143,991,651 M407I probably benign Het
Prdm13 A C 4: 21,679,737 V251G unknown Het
Prkg1 T C 19: 31,664,196 E29G probably damaging Het
Prrc2c A G 1: 162,697,811 S409P unknown Het
Rp1 T A 1: 4,347,718 D1057V probably damaging Het
Rttn G A 18: 89,010,955 C599Y probably damaging Het
Shisa6 C T 11: 66,525,327 R213Q probably benign Het
Slc3a1 T C 17: 85,032,845 Y232H probably damaging Het
Slx4 G A 16: 3,980,089 A1477V probably damaging Het
Ssrp1 T G 2: 85,040,674 I218S probably damaging Het
St6galnac1 A C 11: 116,768,930 S186A probably benign Het
Stab1 A G 14: 31,159,008 probably benign Het
Sycp2 T C 2: 178,346,411 probably benign Het
Syne2 T A 12: 76,072,207 I5867N probably damaging Het
Taar7f T A 10: 24,049,941 D144E probably damaging Het
Tmem136 A T 9: 43,111,753 M84K probably damaging Het
Tmem87b T A 2: 128,831,233 S196T probably damaging Het
Tnfrsf21 A G 17: 43,037,877 T127A probably benign Het
Trp73 A G 4: 154,063,949 I336T probably benign Het
Ttl A G 2: 129,076,061 I148V probably damaging Het
Ttll7 T C 3: 146,944,215 Y667H probably benign Het
Ubr4 A G 4: 139,391,860 T152A probably damaging Het
Vmn1r58 A T 7: 5,410,637 V198E probably damaging Het
Vps52 T A 17: 33,962,117 F376L probably benign Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers
Posted On2013-08-08