Incidental Mutation 'R0080:4732465J04Rik'
List |< first << previous [record 4 of 1259] next >> last >|
ID65757
Institutional Source Beutler Lab
Gene Symbol 4732465J04Rik
Ensembl Gene ENSMUSG00000101517
Gene NameRIKEN cDNA 4732465J04 gene
Synonyms
MMRRC Submission 038367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R0080 (G1)
Quality Score133
Status Validated
Chromosome10
Chromosomal Location95746077-95797236 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC at 95794578 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect probably null
Transcript: ENSMUST00000084674
SMART Domains Protein: ENSMUSP00000081726
Gene: ENSMUSG00000071107

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187483
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 93.1%
  • 20x: 79.7%
Validation Efficiency 88% (175/200)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Adgb T C 10: 10,377,839 probably benign Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Coro7 A T 16: 4,630,464 L714Q probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Dsg1b T G 18: 20,397,367 S360A probably damaging Het
Ednra T C 8: 77,675,059 I201V probably benign Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Ggt6 A G 11: 72,437,195 T136A possibly damaging Het
Gnb5 A T 9: 75,314,354 E28V possibly damaging Het
Golgb1 T C 16: 36,898,611 L293P probably damaging Het
Gpr179 A G 11: 97,351,469 V183A probably benign Het
Grk6 T C 13: 55,458,910 S474P probably benign Het
Hectd4 A G 5: 121,349,372 S3477G probably benign Het
Irx3 T C 8: 91,800,326 D250G possibly damaging Het
Jsrp1 T G 10: 80,810,515 M70L probably benign Het
Kcmf1 G T 6: 72,850,487 probably null Het
Med23 T C 10: 24,912,817 V1368A probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nos1 G T 5: 117,893,878 C297F probably damaging Het
Oas1d G A 5: 120,916,892 A176T possibly damaging Het
Odf2l A T 3: 145,124,323 I19F possibly damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pfkfb2 A T 1: 130,714,542 S5R probably benign Het
Pign G T 1: 105,552,405 A848E probably damaging Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ryr2 T A 13: 11,568,475 K4764N probably damaging Het
Scgb1b19 A G 7: 33,287,642 T73A probably damaging Het
Slc35d3 T C 10: 19,849,198 E304G probably damaging Het
Snta1 A G 2: 154,383,837 V209A probably benign Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tigd4 A G 3: 84,594,145 H123R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trim60 C T 8: 65,000,599 A333T probably damaging Het
Vmn2r82 A T 10: 79,396,505 R779S probably benign Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in 4732465J04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:4732465J04Rik APN 10 95793797 missense probably damaging 0.99
R0164:4732465J04Rik UTSW 10 95794578 frame shift probably null
R1717:4732465J04Rik UTSW 10 95793779 critical splice donor site probably null
Predicted Primers
Posted On2013-08-19