Incidental Mutation 'R0238:Slc4a2'
ID66082
Institutional Source Beutler Lab
Gene Symbol Slc4a2
Ensembl Gene ENSMUSG00000028962
Gene Namesolute carrier family 4 (anion exchanger), member 2
SynonymsB3RP, Ae2
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R0238 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24423837-24440950 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 24436274 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030800] [ENSMUST00000080067] [ENSMUST00000115041] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049] [ENSMUST00000144389]
Predicted Effect probably benign
Transcript: ENSMUST00000030800
SMART Domains Protein: ENSMUSP00000030800
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 274 340 7.4e-18 PFAM
Pfam:FAST_2 351 440 5e-20 PFAM
RAP 475 532 3.04e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080067
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115041
SMART Domains Protein: ENSMUSP00000110693
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 43 57 N/A INTRINSIC
low complexity region 101 112 N/A INTRINSIC
Pfam:FAST_1 136 204 5.4e-24 PFAM
Pfam:FAST_2 212 303 4.7e-26 PFAM
RAP 338 395 3.04e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115043
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115047
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115049
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect probably benign
Transcript: ENSMUST00000144389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Meta Mutation Damage Score 0.6608 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice carrying an isoform-specific allele display male infertility associated with disrupted spermiogenesis and germ cell apoptosis. Mice homozygous for a null allele display perinatal and postnatal lethality, loss of gastric acid secretion, failure of tooth eruption, aphagia, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Slc4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Slc4a2 APN 5 24439068 missense probably damaging 1.00
IGL00772:Slc4a2 APN 5 24435196 missense probably damaging 1.00
IGL00897:Slc4a2 APN 5 24429559 nonsense probably null
IGL01477:Slc4a2 APN 5 24430156 unclassified probably benign
IGL01680:Slc4a2 APN 5 24432930 missense probably benign 0.23
IGL01681:Slc4a2 APN 5 24434187 missense probably damaging 1.00
IGL01808:Slc4a2 APN 5 24440207 missense probably damaging 1.00
IGL02399:Slc4a2 APN 5 24434713 missense probably damaging 1.00
IGL02501:Slc4a2 APN 5 24429434 missense probably benign 0.00
IGL03214:Slc4a2 APN 5 24434881 missense probably benign 0.01
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0309:Slc4a2 UTSW 5 24434346 missense probably damaging 1.00
R0325:Slc4a2 UTSW 5 24435943 missense probably damaging 1.00
R0656:Slc4a2 UTSW 5 24431259 missense probably benign 0.05
R0755:Slc4a2 UTSW 5 24435577 missense probably benign 0.07
R0946:Slc4a2 UTSW 5 24435886 missense probably damaging 1.00
R1075:Slc4a2 UTSW 5 24439057 missense possibly damaging 0.85
R1733:Slc4a2 UTSW 5 24429567 missense probably damaging 1.00
R1794:Slc4a2 UTSW 5 24439328 missense probably damaging 1.00
R1823:Slc4a2 UTSW 5 24427620 missense probably damaging 0.99
R2048:Slc4a2 UTSW 5 24431559 missense probably damaging 1.00
R2165:Slc4a2 UTSW 5 24431316 missense probably damaging 1.00
R2181:Slc4a2 UTSW 5 24435653 missense possibly damaging 0.80
R2405:Slc4a2 UTSW 5 24435601 missense probably damaging 1.00
R3551:Slc4a2 UTSW 5 24430101 missense probably benign 0.01
R4423:Slc4a2 UTSW 5 24439848 nonsense probably null
R4457:Slc4a2 UTSW 5 24434330 unclassified probably benign
R4678:Slc4a2 UTSW 5 24434240 critical splice donor site probably null
R4730:Slc4a2 UTSW 5 24434880 missense probably damaging 1.00
R4824:Slc4a2 UTSW 5 24440143 missense probably damaging 1.00
R4928:Slc4a2 UTSW 5 24435342 critical splice donor site probably null
R4993:Slc4a2 UTSW 5 24434869 missense probably damaging 1.00
R5071:Slc4a2 UTSW 5 24438762 missense probably benign
R5072:Slc4a2 UTSW 5 24438762 missense probably benign
R5073:Slc4a2 UTSW 5 24438762 missense probably benign
R5074:Slc4a2 UTSW 5 24438762 missense probably benign
R5108:Slc4a2 UTSW 5 24439333 missense probably damaging 1.00
R5135:Slc4a2 UTSW 5 24430127 missense possibly damaging 0.78
R5349:Slc4a2 UTSW 5 24435635 missense possibly damaging 0.74
R5601:Slc4a2 UTSW 5 24438774 missense probably benign 0.07
R5666:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R5670:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R6256:Slc4a2 UTSW 5 24435890 missense probably damaging 1.00
R6861:Slc4a2 UTSW 5 24435009 missense probably damaging 1.00
R7360:Slc4a2 UTSW 5 24429715 missense probably benign 0.11
X0027:Slc4a2 UTSW 5 24435914 unclassified probably null
Predicted Primers
Posted On2013-08-19