Incidental Mutation 'R0238:Haus3'
ID66084
Institutional Source Beutler Lab
Gene Symbol Haus3
Ensembl Gene ENSMUSG00000079555
Gene NameHAUS augmin-like complex, subunit 3
SynonymsD5H4S43, D4S43h, D5H4S43E
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0238 (G1)
Quality Score138
Status Not validated
Chromosome5
Chromosomal Location34153880-34169527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34166256 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 337 (P337S)
Ref Sequence ENSEMBL: ENSMUSP00000049973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000060049] [ENSMUST00000202042] [ENSMUST00000202409] [ENSMUST00000202541] [ENSMUST00000202638]
Predicted Effect probably benign
Transcript: ENSMUST00000042954
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000060049
AA Change: P337S

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049973
Gene: ENSMUSG00000079555
AA Change: P337S

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 282 4.8e-85 PFAM
coiled coil region 294 336 N/A INTRINSIC
coiled coil region 459 495 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201069
Predicted Effect probably benign
Transcript: ENSMUST00000202042
SMART Domains Protein: ENSMUSP00000144049
Gene: ENSMUSG00000079555

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 96 7.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202290
Predicted Effect probably benign
Transcript: ENSMUST00000202409
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202541
Predicted Effect probably benign
Transcript: ENSMUST00000202638
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the HAUS augmin-like protein complex, which plays a key role in cytokinesis and mitosis. Disruption of the encoded protein causes mitotic defects resulting from fragmentation of centrosomes and microtubule destabilization. This gene shares its 5' exons with some transcripts from overlapping GeneID: 353497, which encodes a DNA polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit pre- or peri-implantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Haus3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Haus3 APN 5 34167928 missense probably benign 0.00
IGL00990:Haus3 APN 5 34166346 missense probably benign 0.00
IGL01311:Haus3 APN 5 34167644 nonsense probably null
IGL01906:Haus3 APN 5 34168323 intron probably benign
IGL01964:Haus3 APN 5 34166061 missense probably benign 0.19
IGL02383:Haus3 APN 5 34166236 nonsense probably null
IGL02584:Haus3 APN 5 34166258 nonsense probably null
IGL02800:Haus3 APN 5 34166324 missense possibly damaging 0.94
IGL03010:Haus3 APN 5 34166287 missense probably benign 0.04
IGL03371:Haus3 APN 5 34166343 nonsense probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0701:Haus3 UTSW 5 34166015 missense probably benign 0.05
R1527:Haus3 UTSW 5 34154053 missense probably benign 0.00
R1714:Haus3 UTSW 5 34163697 missense probably benign 0.03
R1800:Haus3 UTSW 5 34163572 missense probably damaging 1.00
R4874:Haus3 UTSW 5 34167628 missense probably benign 0.07
R4895:Haus3 UTSW 5 34168070 missense probably benign 0.33
R5268:Haus3 UTSW 5 34166105 missense probably damaging 0.98
R5613:Haus3 UTSW 5 34167829 missense probably damaging 0.98
R6299:Haus3 UTSW 5 34167796 missense probably benign 0.40
R6701:Haus3 UTSW 5 34167734 missense probably damaging 0.99
X0019:Haus3 UTSW 5 34163556 nonsense probably null
X0063:Haus3 UTSW 5 34166222 missense possibly damaging 0.52
Predicted Primers
Posted On2013-08-19