Incidental Mutation 'R0238:Dysf'
Institutional Source Beutler Lab
Gene Symbol Dysf
Ensembl Gene ENSMUSG00000033788
Gene Namedysferlin
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0238 (G1)
Quality Score138
Status Not validated
Chromosomal Location84008590-84211060 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 84064479 bp
Amino Acid Change Glutamine to Stop codon at position 156 (Q156*)
Ref Sequence ENSEMBL: ENSMUSP00000144970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000153860] [ENSMUST00000168387] [ENSMUST00000203695] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000204591] [ENSMUST00000204987]
Predicted Effect probably null
Transcript: ENSMUST00000081904
AA Change: Q157*
SMART Domains Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788
AA Change: Q157*

C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 4.84e-14 SMART
FerI 337 408 5.3e-39 SMART
C2 414 528 2.96e-9 SMART
FerA 714 779 6.3e-23 SMART
FerB 806 880 2.49e-44 SMART
DysFN 894 953 1.42e-22 SMART
DysFN 966 1022 2.65e-22 SMART
DysFC 1031 1069 1.33e-13 SMART
DysFC 1088 1121 1.1e-10 SMART
C2 1173 1281 2.63e-15 SMART
C2 1350 1457 7.13e0 SMART
C2 1599 1698 2.52e-12 SMART
C2 1832 1961 1.55e-3 SMART
Pfam:Ferlin_C 1991 2095 6.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089595
SMART Domains Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788

C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 1.12e-9 SMART
FerA 697 762 6.3e-23 SMART
FerB 789 863 2.49e-44 SMART
DysFN 877 936 1.42e-22 SMART
DysFN 949 1005 2.65e-22 SMART
DysFC 1014 1052 1.33e-13 SMART
DysFC 1071 1104 1.1e-10 SMART
C2 1156 1264 2.63e-15 SMART
C2 1333 1440 7.13e0 SMART
C2 1582 1681 2.52e-12 SMART
C2 1815 1944 1.55e-3 SMART
Pfam:Ferlin_C 1974 2078 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113818
SMART Domains Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788

C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 2.96e-9 SMART
FerA 683 748 6.3e-23 SMART
FerB 775 849 2.49e-44 SMART
DysFN 863 922 1.42e-22 SMART
DysFN 935 991 2.65e-22 SMART
DysFC 1000 1038 1.33e-13 SMART
DysFC 1057 1090 1.1e-10 SMART
C2 1142 1250 2.63e-15 SMART
C2 1319 1426 7.13e0 SMART
C2 1568 1667 2.52e-12 SMART
C2 1801 1930 1.55e-3 SMART
transmembrane domain 2034 2056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113821
SMART Domains Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788

C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 696 761 6.3e-23 SMART
FerB 788 862 2.49e-44 SMART
DysFN 876 935 1.42e-22 SMART
DysFN 948 1004 2.65e-22 SMART
DysFC 1013 1051 1.33e-13 SMART
DysFC 1070 1103 1.1e-10 SMART
C2 1155 1263 2.63e-15 SMART
C2 1332 1439 7.13e0 SMART
C2 1581 1680 2.52e-12 SMART
C2 1814 1943 1.55e-3 SMART
transmembrane domain 2047 2069 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113823
AA Change: Q156*
SMART Domains Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788
AA Change: Q156*

C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 4.84e-14 SMART
FerI 336 407 5.3e-39 SMART
C2 413 527 2.96e-9 SMART
FerA 713 778 6.3e-23 SMART
FerB 805 879 2.49e-44 SMART
DysFN 893 952 1.42e-22 SMART
DysFN 965 1021 2.65e-22 SMART
DysFC 1030 1068 1.33e-13 SMART
DysFC 1087 1120 1.1e-10 SMART
C2 1172 1280 2.63e-15 SMART
C2 1349 1456 7.13e0 SMART
C2 1598 1697 2.52e-12 SMART
C2 1831 1960 1.55e-3 SMART
transmembrane domain 2064 2086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153860
SMART Domains Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788

C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 3.2e-16 SMART
FerI 305 376 2.6e-43 SMART
C2 382 496 7.4e-12 SMART
FerA 696 761 3.1e-27 SMART
FerB 788 862 1.2e-48 SMART
DysFN 876 935 5.3e-25 SMART
DysFN 948 1004 9.6e-25 SMART
DysFC 1013 1051 4.7e-16 SMART
DysFC 1070 1103 4.1e-13 SMART
C2 1155 1263 1.7e-17 SMART
C2 1332 1439 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168387
SMART Domains Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788

C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 704 769 6.3e-23 SMART
FerB 796 870 2.49e-44 SMART
DysFN 884 943 1.42e-22 SMART
DysFN 956 1012 2.65e-22 SMART
DysFC 1021 1059 1.33e-13 SMART
DysFC 1078 1111 1.1e-10 SMART
C2 1163 1271 2.63e-15 SMART
C2 1340 1447 7.13e0 SMART
C2 1589 1688 2.52e-12 SMART
C2 1822 1951 1.55e-3 SMART
transmembrane domain 2055 2077 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203695
AA Change: Q157*
SMART Domains Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788
AA Change: Q157*

C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 3.2e-16 SMART
FerI 337 408 2.6e-43 SMART
C2 414 528 7.4e-12 SMART
FerA 728 793 3.1e-27 SMART
FerB 820 894 1.2e-48 SMART
DysFN 908 967 5.3e-25 SMART
DysFN 980 1036 9.6e-25 SMART
DysFC 1045 1083 4.7e-16 SMART
DysFC 1102 1135 4.1e-13 SMART
C2 1187 1295 1.7e-17 SMART
C2 1364 1471 4.7e-2 SMART
C2 1613 1712 1.7e-14 SMART
C2 1846 1975 1.1e-5 SMART
Pfam:Ferlin_C 2005 2109 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203803
AA Change: Q156*
SMART Domains Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788
AA Change: Q156*

C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 7.4e-12 SMART
FerA 727 792 3.1e-27 SMART
FerB 819 893 1.2e-48 SMART
DysFN 907 966 5.3e-25 SMART
DysFN 979 1035 9.6e-25 SMART
DysFC 1044 1082 4.7e-16 SMART
DysFC 1101 1134 4.1e-13 SMART
C2 1186 1294 1.7e-17 SMART
C2 1353 1460 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204354
SMART Domains Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788

C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 2e-11 SMART
FerA 683 748 3.1e-27 SMART
FerB 775 849 1.2e-48 SMART
DysFN 863 922 5.3e-25 SMART
DysFN 935 991 9.6e-25 SMART
DysFC 1000 1038 4.7e-16 SMART
DysFC 1057 1090 4.1e-13 SMART
C2 1142 1250 1.7e-17 SMART
C2 1319 1426 4.7e-2 SMART
C2 1589 1688 1.7e-14 SMART
C2 1822 1951 1.1e-5 SMART
Pfam:Ferlin_C 1981 2085 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204591
AA Change: Q156*
SMART Domains Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788
AA Change: Q156*

C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 2e-11 SMART
FerA 713 778 3.1e-27 SMART
FerB 805 879 1.2e-48 SMART
DysFN 893 952 5.3e-25 SMART
DysFN 965 1021 9.6e-25 SMART
DysFC 1030 1068 4.7e-16 SMART
DysFC 1087 1120 4.1e-13 SMART
C2 1172 1280 1.7e-17 SMART
C2 1349 1456 4.7e-2 SMART
C2 1619 1718 1.7e-14 SMART
C2 1852 1981 1.1e-5 SMART
Pfam:Ferlin_C 2011 2115 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204987
SMART Domains Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788

C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 7.4e-12 SMART
FerA 697 762 3.1e-27 SMART
FerB 789 863 1.2e-48 SMART
DysFN 877 936 5.3e-25 SMART
DysFN 949 1005 9.6e-25 SMART
DysFC 1014 1052 4.7e-16 SMART
DysFC 1071 1104 4.1e-13 SMART
C2 1156 1264 1.7e-17 SMART
C2 1333 1440 4.7e-2 SMART
C2 1603 1702 1.7e-14 SMART
C2 1836 1965 1.1e-5 SMART
Pfam:Ferlin_C 1995 2099 4.4e-22 PFAM
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Dysf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Dysf APN 6 84108099 missense probably damaging 1.00
IGL00340:Dysf APN 6 84141951 missense probably benign 0.02
IGL00429:Dysf APN 6 84189844 missense probably damaging 1.00
IGL00465:Dysf APN 6 84199848 critical splice donor site probably null
IGL00800:Dysf APN 6 84149998 missense probably damaging 1.00
IGL01069:Dysf APN 6 84199785 missense possibly damaging 0.94
IGL01094:Dysf APN 6 84194386 missense probably damaging 1.00
IGL01420:Dysf APN 6 84149759 nonsense probably null
IGL01649:Dysf APN 6 84199839 missense probably damaging 1.00
IGL01923:Dysf APN 6 84210829 makesense probably null
IGL01991:Dysf APN 6 84113618 missense probably damaging 1.00
IGL01999:Dysf APN 6 84113618 missense probably damaging 1.00
IGL02002:Dysf APN 6 84210787 splice site probably benign
IGL02136:Dysf APN 6 84108167 missense probably benign 0.43
IGL02318:Dysf APN 6 84186464 missense possibly damaging 0.50
IGL02378:Dysf APN 6 84111905 missense probably damaging 1.00
IGL02404:Dysf APN 6 84116061 missense probably damaging 1.00
IGL02416:Dysf APN 6 84192914 missense possibly damaging 0.92
IGL02535:Dysf APN 6 84149697 missense possibly damaging 0.45
IGL02553:Dysf APN 6 84130127 missense possibly damaging 0.95
IGL02559:Dysf APN 6 84067446 splice site probably benign
IGL02563:Dysf APN 6 84186516 splice site probably benign
IGL02647:Dysf APN 6 84137373 missense probably damaging 1.00
IGL02820:Dysf APN 6 84100205 missense probably damaging 0.99
IGL02858:Dysf APN 6 84099489 missense probably benign 0.01
IGL02860:Dysf APN 6 84190898 critical splice donor site probably null
IGL02861:Dysf APN 6 84039537 missense probably damaging 0.99
IGL03008:Dysf APN 6 84073894 missense probably benign 0.01
IGL03023:Dysf APN 6 84193007 missense probably damaging 1.00
IGL03074:Dysf APN 6 84188226 missense probably benign 0.25
IGL03342:Dysf APN 6 84190872 missense probably benign
PIT4305001:Dysf UTSW 6 84100234 nonsense probably null
R0067:Dysf UTSW 6 84063331 missense possibly damaging 0.58
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0124:Dysf UTSW 6 84065102 splice site probably benign
R0219:Dysf UTSW 6 84129461 splice site probably benign
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0426:Dysf UTSW 6 84149757 missense probably damaging 1.00
R0455:Dysf UTSW 6 84140667 missense probably benign 0.29
R0482:Dysf UTSW 6 84152405 missense probably benign 0.03
R0545:Dysf UTSW 6 84099461 missense probably damaging 0.99
R0625:Dysf UTSW 6 84111987 splice site probably null
R0676:Dysf UTSW 6 84113336 missense probably benign 0.07
R0699:Dysf UTSW 6 84190846 missense probably benign 0.00
R1165:Dysf UTSW 6 84067069 missense probably damaging 0.98
R1455:Dysf UTSW 6 84113386 missense probably benign 0.01
R1582:Dysf UTSW 6 84097767 missense probably damaging 1.00
R1584:Dysf UTSW 6 84067047 missense probably benign 0.04
R1605:Dysf UTSW 6 84106941 missense probably damaging 0.96
R1674:Dysf UTSW 6 84179715 missense probably benign 0.01
R1739:Dysf UTSW 6 84112235 critical splice donor site probably null
R1765:Dysf UTSW 6 84190902 splice site probably null
R1813:Dysf UTSW 6 84151924 missense possibly damaging 0.83
R1900:Dysf UTSW 6 84039567 missense probably damaging 0.97
R1960:Dysf UTSW 6 84073903 missense probably benign 0.12
R2216:Dysf UTSW 6 84207245 splice site probably null
R2242:Dysf UTSW 6 84186509 critical splice donor site probably null
R2243:Dysf UTSW 6 84186509 critical splice donor site probably null
R2245:Dysf UTSW 6 84186509 critical splice donor site probably null
R2246:Dysf UTSW 6 84186509 critical splice donor site probably null
R2280:Dysf UTSW 6 84064494 missense probably damaging 0.99
R2374:Dysf UTSW 6 84097729 missense probably damaging 1.00
R2403:Dysf UTSW 6 84039567 missense possibly damaging 0.84
R2763:Dysf UTSW 6 84106932 missense probably benign 0.00
R2895:Dysf UTSW 6 84186509 critical splice donor site probably null
R2916:Dysf UTSW 6 84186509 critical splice donor site probably null
R2918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3402:Dysf UTSW 6 84186509 critical splice donor site probably null
R3403:Dysf UTSW 6 84186509 critical splice donor site probably null
R3434:Dysf UTSW 6 84070888 missense probably benign 0.00
R3772:Dysf UTSW 6 84152351 missense possibly damaging 0.63
R3781:Dysf UTSW 6 84186509 critical splice donor site probably null
R3789:Dysf UTSW 6 84186509 critical splice donor site probably null
R3822:Dysf UTSW 6 84207088 splice site probably benign
R3918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3919:Dysf UTSW 6 84186509 critical splice donor site probably null
R3939:Dysf UTSW 6 84186509 critical splice donor site probably null
R3942:Dysf UTSW 6 84186509 critical splice donor site probably null
R4177:Dysf UTSW 6 84067031 nonsense probably null
R4179:Dysf UTSW 6 84186509 critical splice donor site probably null
R4180:Dysf UTSW 6 84186509 critical splice donor site probably null
R4299:Dysf UTSW 6 84068077 missense possibly damaging 0.78
R4419:Dysf UTSW 6 84207242 critical splice donor site probably null
R4446:Dysf UTSW 6 84205872 missense probably damaging 1.00
R4577:Dysf UTSW 6 84137326 missense probably damaging 1.00
R4680:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4708:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4709:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4710:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4725:Dysf UTSW 6 84097756 missense probably damaging 1.00
R4742:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4743:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4749:Dysf UTSW 6 84067008 missense probably damaging 1.00
R4787:Dysf UTSW 6 84203328 nonsense probably null
R4850:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4868:Dysf UTSW 6 84179693 missense probably damaging 1.00
R4871:Dysf UTSW 6 84067023 missense possibly damaging 0.93
R4951:Dysf UTSW 6 84114120 critical splice donor site probably null
R4952:Dysf UTSW 6 84149986 missense possibly damaging 0.79
R5009:Dysf UTSW 6 84151986 missense probably damaging 1.00
R5072:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5073:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5074:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5252:Dysf UTSW 6 84186468 missense probably damaging 0.98
R5260:Dysf UTSW 6 84150034 missense probably damaging 1.00
R5447:Dysf UTSW 6 84195263 missense probably damaging 0.98
R5501:Dysf UTSW 6 84087818 missense probably damaging 0.99
R5533:Dysf UTSW 6 84186471 missense probably damaging 0.99
R5611:Dysf UTSW 6 84064878 missense probably damaging 0.98
R5618:Dysf UTSW 6 84106824 missense probably benign 0.03
R5884:Dysf UTSW 6 84186081 missense probably damaging 1.00
R5927:Dysf UTSW 6 84207212 missense probably damaging 1.00
R6045:Dysf UTSW 6 84114072 missense probably damaging 0.99
R6056:Dysf UTSW 6 84106862 missense probably benign
R6084:Dysf UTSW 6 84019604 missense probably damaging 0.98
R6084:Dysf UTSW 6 84112119 missense probably damaging 1.00
R6146:Dysf UTSW 6 84203199 missense probably damaging 0.96
R6220:Dysf UTSW 6 84149745 missense probably damaging 0.97
R6232:Dysf UTSW 6 84098253 missense probably benign 0.26
R6247:Dysf UTSW 6 84066999 missense probably damaging 1.00
R6298:Dysf UTSW 6 84107136 intron probably null
R6306:Dysf UTSW 6 84137266 missense possibly damaging 0.91
R6377:Dysf UTSW 6 84008963 missense probably benign
R6415:Dysf UTSW 6 84140042 missense probably damaging 1.00
R6444:Dysf UTSW 6 84190840 missense probably benign 0.36
R6470:Dysf UTSW 6 84066944 missense possibly damaging 0.93
R6504:Dysf UTSW 6 84008925 missense probably benign 0.03
R6557:Dysf UTSW 6 84186384 missense probably damaging 0.99
R6665:Dysf UTSW 6 84130116 missense probably benign
R6701:Dysf UTSW 6 84112190 missense probably damaging 1.00
R6776:Dysf UTSW 6 84064894 missense possibly damaging 0.88
R6909:Dysf UTSW 6 84192938 missense probably damaging 1.00
R7007:Dysf UTSW 6 84113980 missense probably damaging 1.00
R7013:Dysf UTSW 6 84137358 missense probably damaging 1.00
R7035:Dysf UTSW 6 84186392 missense probably benign 0.02
R7094:Dysf UTSW 6 84100202 missense probably benign 0.43
R7124:Dysf UTSW 6 84190901 splice site probably null
R7156:Dysf UTSW 6 84087876 critical splice donor site probably null
R7261:Dysf UTSW 6 84193010 missense probably damaging 0.98
X0063:Dysf UTSW 6 84063354 missense probably damaging 0.97
X0066:Dysf UTSW 6 84114102 missense possibly damaging 0.77
Predicted Primers
Posted On2013-08-19