Incidental Mutation 'R0238:Dnhd1'
ID66100
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Namedynein heavy chain domain 1
Synonyms8030491N06Rik
MMRRC Submission 038476-MU
Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2:  ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0238 (G1)
Quality Score200
Status Not validated
Chromosome7
Chromosomal Location105650827-105721799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105721531 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 4673 (S4673G)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
Predicted Effect probably benign
Transcript: ENSMUST00000145988
AA Change: S4673G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: S4673G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105677995 missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105657211 missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105692675 missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105721688 missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105713909 missense probably benign
IGL01714:Dnhd1 APN 7 105720942 missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105713754 missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105652030 missense probably benign
IGL01999:Dnhd1 APN 7 105721215 missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105678309 missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105720802 missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105721744 missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105721481 missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105720741 missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105719882 missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105714475 missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105713733 missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105655723 missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105668514 missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105720924 missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105720114 missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105694395 missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105714045 missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105651624 missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105695751 missense probably benign
R0669:Dnhd1 UTSW 7 105693704 missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105651906 missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105709171 missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105713031 missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105696899 missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105694153 missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105720124 missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105721273 critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105668463 missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105693660 missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105704148 missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105703206 missense probably benign 0.00
R1615:Dnhd1 UTSW 7 105713706 missense possibly damaging 0.74
R1656:Dnhd1 UTSW 7 105714281 missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105693828 missense probably benign
R1723:Dnhd1 UTSW 7 105714920 missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105693972 missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105655767 missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105704205 missense probably benign
R1920:Dnhd1 UTSW 7 105713407 missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105652252 missense probably damaging 1.00
R1925:Dnhd1 UTSW 7 105673854 missense probably damaging 0.96
R1934:Dnhd1 UTSW 7 105708582 missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105704921 missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105677971 missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105693721 missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105703772 missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105705399 missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105674421 missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105710090 missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105703467 missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105693664 missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105720231 missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105712559 missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105720229 missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105696565 critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105694761 nonsense probably null
R3405:Dnhd1 UTSW 7 105694761 nonsense probably null
R3439:Dnhd1 UTSW 7 105694785 missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105713122 missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105714838 missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105709588 missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105712998 missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105696728 nonsense probably null
R4565:Dnhd1 UTSW 7 105651956 missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105657166 splice site probably null
R4584:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105714030 missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105715446 missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105703644 missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105655741 missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105721117 missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105714281 missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105703964 missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105714808 missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105656957 missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105713633 missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105713076 missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105693697 missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105713440 missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105714552 missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105696460 missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105703923 missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105685761 missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105674037 missense probably benign
R5258:Dnhd1 UTSW 7 105674037 missense probably benign
R5273:Dnhd1 UTSW 7 105714482 missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105714437 missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105713684 missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105710123 missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105714156 missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105714821 missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105674188 missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105705010 missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105655774 missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105719895 missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105720181 missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105695748 missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105720504 missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105713987 missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105709440 missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105704048 missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105652009 missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105693370 missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105694066 missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105694610 missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105677886 missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105703799 missense probably benign
R6663:Dnhd1 UTSW 7 105685692 intron probably null
R6730:Dnhd1 UTSW 7 105703875 missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105720637 missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105703373 missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105719930 missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105703728 missense probably benign
R6860:Dnhd1 UTSW 7 105678266 missense probably benign
R6898:Dnhd1 UTSW 7 105687377 missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105715563 missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105713688 missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105704585 missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105714210 missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105720798 missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105694954 missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105715261 missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105708532 missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105713985 missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105693766 missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105710027 missense probably benign 0.03
Z1088:Dnhd1 UTSW 7 105712727 missense probably benign 0.00
Predicted Primers
Posted On2013-08-19