Incidental Mutation 'R0238:Flcn'
ID66127
Institutional Source Beutler Lab
Gene Symbol Flcn
Ensembl Gene ENSMUSG00000032633
Gene Namefolliculin
SynonymsB430214A04Rik, BHD
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0238 (G1)
Quality Score175
Status Not validated
Chromosome11
Chromosomal Location59791408-59810016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59801076 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 249 (N249S)
Ref Sequence ENSEMBL: ENSMUSP00000099758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047706] [ENSMUST00000091246] [ENSMUST00000102697]
Predicted Effect probably benign
Transcript: ENSMUST00000047706
SMART Domains Protein: ENSMUSP00000037675
Gene: ENSMUSG00000032633

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091246
AA Change: N249S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091696
Gene: ENSMUSG00000032633
AA Change: N249S

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 103 267 3.5e-59 PFAM
low complexity region 293 308 N/A INTRINSIC
PDB:3V42|B 342 566 1e-144 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000102697
AA Change: N249S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099758
Gene: ENSMUSG00000032633
AA Change: N249S

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 104 265 1.5e-55 PFAM
low complexity region 293 308 N/A INTRINSIC
Pfam:Folliculin_C 344 566 8.4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148151
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two different knock-out alleles exhibit prenatal lethality. Mice homozygous for a gene-trapped allele show prenatal lethality while a fraction of heterozygotes develop spontaneous oncocytic renal cysts and solid renal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Flcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Flcn APN 11 59795823 missense probably damaging 1.00
IGL01890:Flcn APN 11 59795170 missense probably benign 0.00
IGL02486:Flcn APN 11 59801043 nonsense probably null
IGL02933:Flcn APN 11 59803757 missense probably damaging 1.00
IGL02935:Flcn APN 11 59795236 missense possibly damaging 0.93
IGL03246:Flcn APN 11 59794110 missense possibly damaging 0.82
pansy UTSW 11 59792659 missense probably damaging 0.99
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0265:Flcn UTSW 11 59795809 nonsense probably null
R0534:Flcn UTSW 11 59794199 splice site probably benign
R0551:Flcn UTSW 11 59795748 critical splice donor site probably null
R1016:Flcn UTSW 11 59795865 critical splice acceptor site probably null
R1108:Flcn UTSW 11 59801200 missense possibly damaging 0.77
R2350:Flcn UTSW 11 59792659 missense probably damaging 0.99
R4158:Flcn UTSW 11 59801121 missense probably benign 0.26
R4367:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4371:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4612:Flcn UTSW 11 59792687 missense probably damaging 1.00
R4689:Flcn UTSW 11 59801044 missense possibly damaging 0.87
R5849:Flcn UTSW 11 59804760 missense probably damaging 0.99
R6007:Flcn UTSW 11 59792622 missense probably benign 0.08
R6433:Flcn UTSW 11 59801082 missense probably damaging 0.97
R6525:Flcn UTSW 11 59794172 missense possibly damaging 0.75
R7027:Flcn UTSW 11 59795806 missense probably damaging 1.00
X0002:Flcn UTSW 11 59804537 missense probably damaging 0.99
Predicted Primers
Posted On2013-08-19