Incidental Mutation 'R0418:Zic2'
ID 66341
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Name zinc finger protein of the cerebellum 2
Synonyms odd-paired homolog, GENA 29, Ku
MMRRC Submission 038620-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R0418 (G1)
Quality Score 200
Status Validated
Chromosome 14
Chromosomal Location 122712847-122717264 bp(+) (GRCm39)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122713776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075888
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 103,953,675 (GRCm39) probably null Het
Abca14 T C 7: 119,806,657 (GRCm39) L19P probably damaging Het
Abcb1a T A 5: 8,763,281 (GRCm39) V603E probably damaging Het
Acsl5 A G 19: 55,261,238 (GRCm39) D65G probably benign Het
Acss3 T C 10: 106,859,773 (GRCm39) Y311C probably damaging Het
Ak8 T G 2: 28,623,868 (GRCm39) I151S possibly damaging Het
Aldh1a1 T C 19: 20,606,413 (GRCm39) probably benign Het
Aldh1l1 A G 6: 90,546,875 (GRCm39) R393G possibly damaging Het
Ankhd1 T A 18: 36,767,353 (GRCm39) L1164Q probably damaging Het
Ascc3 G T 10: 50,625,022 (GRCm39) V1637L probably benign Het
Atf5 A G 7: 44,462,821 (GRCm39) M101T possibly damaging Het
Det1 T C 7: 78,493,765 (GRCm39) T80A probably benign Het
Dpp9 C T 17: 56,501,404 (GRCm39) probably benign Het
Fam13c A G 10: 70,370,591 (GRCm39) R244G probably damaging Het
Fat3 A T 9: 16,158,192 (GRCm39) N1139K probably damaging Het
Fbxo17 A G 7: 28,432,916 (GRCm39) T146A possibly damaging Het
Fli1 T C 9: 32,363,425 (GRCm39) probably benign Het
Glb1l2 T G 9: 26,705,397 (GRCm39) D151A probably damaging Het
Gli2 G A 1: 118,768,220 (GRCm39) T669I possibly damaging Het
Igsf3 C A 3: 101,342,751 (GRCm39) R463S probably damaging Het
Il1rl2 T C 1: 40,365,662 (GRCm39) V3A unknown Het
Irx3 G A 8: 92,526,708 (GRCm39) S332F probably benign Het
Katnb1 C T 8: 95,822,286 (GRCm39) T303M possibly damaging Het
Lrrc31 A T 3: 30,743,383 (GRCm39) L194Q probably damaging Het
Lrrc37a T G 11: 103,394,264 (GRCm39) E387A probably benign Het
Mapk14 T C 17: 28,910,763 (GRCm39) I17T probably benign Het
Mtif2 A G 11: 29,483,401 (GRCm39) probably benign Het
Myo16 A G 8: 10,619,918 (GRCm39) T1490A probably benign Het
Nfasc A G 1: 132,539,333 (GRCm39) V399A probably damaging Het
Nhsl3 A G 4: 129,117,477 (GRCm39) S396P probably damaging Het
Nobox T C 6: 43,284,169 (GRCm39) K1E probably null Het
Nr2c1 A T 10: 94,017,374 (GRCm39) M371L probably benign Het
Oplah C T 15: 76,182,687 (GRCm39) R924H probably benign Het
Or10ak16 C T 4: 118,750,448 (GRCm39) T56I possibly damaging Het
Or51a10 G A 7: 103,698,979 (GRCm39) T194I probably benign Het
Pappa2 C A 1: 158,544,560 (GRCm39) C1756F probably damaging Het
Pdzd8 G A 19: 59,289,361 (GRCm39) R680C probably damaging Het
Rassf3 G A 10: 121,253,075 (GRCm39) T44M probably benign Het
Rmnd1 T C 10: 4,377,693 (GRCm39) probably null Het
Rnf126 C T 10: 79,598,477 (GRCm39) probably benign Het
Rnf144b T C 13: 47,397,966 (GRCm39) S299P probably benign Het
Ryr2 A G 13: 11,848,981 (GRCm39) probably benign Het
Scel T A 14: 103,840,690 (GRCm39) S511T probably benign Het
Slc16a10 G T 10: 39,916,627 (GRCm39) S138* probably null Het
Slc36a4 A T 9: 15,645,562 (GRCm39) I330F probably damaging Het
Slc5a8 A G 10: 88,722,420 (GRCm39) I84M probably benign Het
Spag9 T C 11: 93,982,579 (GRCm39) probably benign Het
Suco C T 1: 161,662,419 (GRCm39) V671I probably benign Het
Suox G A 10: 128,506,754 (GRCm39) P425S probably damaging Het
Tmem266 T A 9: 55,344,697 (GRCm39) V443E probably benign Het
Tmprss11f A T 5: 86,704,870 (GRCm39) I16N probably benign Het
Tnik T A 3: 28,625,029 (GRCm39) Y321* probably null Het
Tnrc6b T C 15: 80,797,524 (GRCm39) M1357T probably benign Het
Tpbg C A 9: 85,726,803 (GRCm39) Y257* probably null Het
Usp37 A T 1: 74,529,266 (GRCm39) S138T probably benign Het
Veph1 T A 3: 66,162,449 (GRCm39) R70* probably null Het
Vmn2r17 C T 5: 109,600,747 (GRCm39) P682S probably damaging Het
Vmn2r79 A C 7: 86,651,611 (GRCm39) N337H probably benign Het
Vstm2b A G 7: 40,551,876 (GRCm39) D68G probably damaging Het
Vwa7 G T 17: 35,236,933 (GRCm39) A167S possibly damaging Het
Zfp647 A T 15: 76,795,586 (GRCm39) I358N probably damaging Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122,715,971 (GRCm39) nonsense probably null
IGL01607:Zic2 APN 14 122,716,294 (GRCm39) splice site probably benign
IGL02307:Zic2 APN 14 122,714,046 (GRCm39) missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122,713,606 (GRCm39) missense probably damaging 0.99
IGL02561:Zic2 APN 14 122,715,957 (GRCm39) nonsense probably null
IGL02982:Zic2 APN 14 122,715,979 (GRCm39) missense probably damaging 0.98
R0001:Zic2 UTSW 14 122,716,369 (GRCm39) missense probably damaging 0.99
R0027:Zic2 UTSW 14 122,713,755 (GRCm39) missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122,713,953 (GRCm39) missense probably damaging 0.96
R0310:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0420:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0421:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0518:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0520:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0521:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0628:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R1733:Zic2 UTSW 14 122,716,359 (GRCm39) missense probably damaging 0.97
R1757:Zic2 UTSW 14 122,716,031 (GRCm39) missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122,716,329 (GRCm39) nonsense probably null
R5323:Zic2 UTSW 14 122,713,728 (GRCm39) missense probably damaging 1.00
R5381:Zic2 UTSW 14 122,713,227 (GRCm39) missense probably damaging 0.97
R6930:Zic2 UTSW 14 122,713,869 (GRCm39) missense probably damaging 0.99
R7223:Zic2 UTSW 14 122,713,503 (GRCm39) missense probably damaging 0.98
R8750:Zic2 UTSW 14 122,714,129 (GRCm39) missense probably benign 0.06
R8852:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
R8860:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
Z1088:Zic2 UTSW 14 122,716,087 (GRCm39) missense probably damaging 0.98
Predicted Primers
Posted On 2013-08-19