Mutagenetix > Incidental Mutation

Incidental Mutation 'R0420:Zic2'

66342

Institutional Source

Beutler Lab

Gene Symbol

Zic2

Ensembl Gene

ENSMUSG00000061524

Gene Name

zinc finger protein of the cerebellum 2

Synonyms

odd-paired homolog, GENA 29, Ku

MMRRC Submission

038622-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.902) question?

Stock #

R0420 (G1)

Quality Score

135

Status

Validated

Chromosome

Chromosomal Location

122712847-122717264 bp(+) (GRCm39)

Type of Mutation

small deletion (2 aa in frame mutation)

DNA Base Change (assembly)

CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122713776 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000075283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075888]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075888

SMART Domains

Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
low complexity region	81	103	N/A	INTRINSIC
low complexity region	131	150	N/A	INTRINSIC
low complexity region	215	241	N/A	INTRINSIC
ZnF_C2H2	265	290	5.68e1	SMART
ZnF_C2H2	299	326	6.92e0	SMART
ZnF_C2H2	332	356	8.02e-5	SMART
ZnF_C2H2	362	386	1.69e-3	SMART
ZnF_C2H2	392	414	4.54e-4	SMART
low complexity region	416	434	N/A	INTRINSIC
low complexity region	455	519	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135485

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177306

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.2%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	C	5: 8,991,050 (GRCm39)	V870A	probably benign	Het
Adam6b	A	T	12: 113,453,614 (GRCm39)	M144L	probably benign	Het
Adrb2	T	A	18: 62,312,610 (GRCm39)	I72L	possibly damaging	Het
Ankrd53	A	T	6: 83,740,674 (GRCm39)	H99L	probably damaging	Het
Ap4e1	C	T	2: 126,891,280 (GRCm39)	T17M	probably damaging	Het
Arnt	T	A	3: 95,377,705 (GRCm39)		probably benign	Het
Atp1a3	C	T	7: 24,680,052 (GRCm39)	G884E	probably benign	Het
Atp6v1b1	T	C	6: 83,729,826 (GRCm39)		probably benign	Het
Atp8a2	G	T	14: 60,011,193 (GRCm39)	T971K	probably damaging	Het
BC048562	A	T	9: 108,323,165 (GRCm39)	T167S	probably benign	Het
Brd9	A	G	13: 74,103,592 (GRCm39)	M491V	probably benign	Het
Btnl10	A	T	11: 58,814,277 (GRCm39)	D319V	probably damaging	Het
Cadps	T	A	14: 12,491,800 (GRCm38)	R783S	probably damaging	Het
Ccdc149	A	G	5: 52,557,581 (GRCm39)		probably benign	Het
Ccm2l	A	T	2: 152,912,782 (GRCm39)	D107V	probably null	Het
Cep192	A	G	18: 67,946,964 (GRCm39)	E213G	possibly damaging	Het
Cyp2c37	A	C	19: 39,984,238 (GRCm39)	N242T	probably benign	Het
Dnah17	A	G	11: 117,930,765 (GRCm39)	V3750A	probably damaging	Het
Ehbp1	T	A	11: 22,101,836 (GRCm39)	I231L	probably benign	Het
Emilin3	A	G	2: 160,752,799 (GRCm39)		probably benign	Het
Eya4	T	C	10: 23,031,861 (GRCm39)	N254S	possibly damaging	Het
Fam184b	A	G	5: 45,741,854 (GRCm39)	S126P	probably damaging	Het
Fancd2	T	C	6: 113,513,940 (GRCm39)	L108P	probably damaging	Het
Fgf12	A	T	16: 27,981,281 (GRCm39)	M145K	possibly damaging	Het
Gabbr1	A	G	17: 37,357,654 (GRCm39)	N23S	possibly damaging	Het
Ggt1	T	A	10: 75,412,047 (GRCm39)		probably benign	Het
Gm6434	T	A	7: 25,581,786 (GRCm39)		noncoding transcript	Het
Grik4	A	T	9: 42,533,392 (GRCm39)	L376*	probably null	Het
Gvin3	T	A	7: 106,203,090 (GRCm39)	L51F	probably damaging	Het
Gzf1	A	G	2: 148,525,753 (GRCm39)	T75A	probably benign	Het
Hcn1	T	C	13: 118,111,911 (GRCm39)	I625T	unknown	Het
Hhat	C	T	1: 192,235,242 (GRCm39)		probably null	Het
Ifit1bl1	T	C	19: 34,571,914 (GRCm39)	E181G	probably damaging	Het
Kif21a	T	C	15: 90,852,257 (GRCm39)		probably benign	Het
Lrrc45	A	C	11: 120,606,045 (GRCm39)	S118R	probably damaging	Het
Mcm9	T	C	10: 53,424,623 (GRCm39)	I656V	probably benign	Het
Ms4a5	A	G	19: 11,261,018 (GRCm39)	L47S	probably damaging	Het
Mynn	A	T	3: 30,661,608 (GRCm39)	N230I	probably benign	Het
Nck2	T	C	1: 43,593,278 (GRCm39)	S162P	probably damaging	Het
Nfat5	T	C	8: 108,094,093 (GRCm39)	F259S	probably damaging	Het
Obox1	T	G	7: 15,290,178 (GRCm39)	S174A	possibly damaging	Het
Ociad1	T	A	5: 73,470,772 (GRCm39)		probably null	Het
Pgbd1	A	T	13: 21,607,336 (GRCm39)	V286E	possibly damaging	Het
Phlpp2	T	C	8: 110,666,567 (GRCm39)	V1032A	probably damaging	Het
Ppm1e	C	T	11: 87,131,440 (GRCm39)	A318T	probably damaging	Het
Prex1	T	A	2: 166,431,491 (GRCm39)	D757V	probably benign	Het
Ptpdc1	C	A	13: 48,742,595 (GRCm39)		probably null	Het
Rbbp5	T	G	1: 132,421,582 (GRCm39)	I94R	possibly damaging	Het
Rnpc3	A	G	3: 113,415,518 (GRCm39)	V173A	probably benign	Het
Sgsm1	A	T	5: 113,411,625 (GRCm39)	N700K	probably benign	Het
Slco1a8	T	G	6: 141,931,203 (GRCm39)		probably benign	Het
Sox14	T	A	9: 99,757,175 (GRCm39)	H188L	probably damaging	Het
Spmip11	A	G	15: 98,468,975 (GRCm39)	S17G	probably benign	Het
Supt5	T	A	7: 28,016,754 (GRCm39)		probably benign	Het
Synpo	A	G	18: 60,735,490 (GRCm39)	S819P	probably damaging	Het
Tenm2	A	G	11: 36,097,951 (GRCm39)		probably benign	Het
Tenm4	T	C	7: 96,522,973 (GRCm39)	V1468A	possibly damaging	Het
Tiam2	A	G	17: 3,553,193 (GRCm39)	N83S	probably benign	Het
Tle6	T	C	10: 81,431,145 (GRCm39)		probably benign	Het
Tm2d2	T	G	8: 25,508,130 (GRCm39)	N91K	probably damaging	Het
Tmem132d	T	G	5: 127,941,710 (GRCm39)	Q463H	probably benign	Het
Tmf1	A	G	6: 97,153,102 (GRCm39)	S324P	probably damaging	Het
Tnc	T	C	4: 63,918,396 (GRCm39)	T1172A	probably benign	Het
Usp17lb	A	T	7: 104,489,746 (GRCm39)	C393S	probably benign	Het
Usp42	G	A	5: 143,700,616 (GRCm39)	L1136F	probably damaging	Het
Vmn2r92	T	G	17: 18,389,183 (GRCm39)	M499R	probably benign	Het
Vps54	T	A	11: 21,261,071 (GRCm39)		probably benign	Het
Wdr6	C	T	9: 108,450,300 (GRCm39)	R1076H	probably benign	Het
Wdr72	T	A	9: 74,118,039 (GRCm39)	M917K	possibly damaging	Het
Wee2	T	C	6: 40,433,929 (GRCm39)	V281A	probably benign	Het
Zc3h6	A	G	2: 128,856,747 (GRCm39)	D609G	probably benign	Het
Zfp345	G	A	2: 150,315,163 (GRCm39)	H125Y	possibly damaging	Het
Zhx2	A	G	15: 57,685,236 (GRCm39)	K202E	probably damaging	Het

Other mutations in Zic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Zic2	APN	14	122,715,971 (GRCm39)	nonsense	probably null
IGL01607:Zic2	APN	14	122,716,294 (GRCm39)	splice site	probably benign
IGL02307:Zic2	APN	14	122,714,046 (GRCm39)	missense	possibly damaging	0.76
IGL02311:Zic2	APN	14	122,713,606 (GRCm39)	missense	probably damaging	0.99
IGL02561:Zic2	APN	14	122,715,957 (GRCm39)	nonsense	probably null
IGL02982:Zic2	APN	14	122,715,979 (GRCm39)	missense	probably damaging	0.98
R0001:Zic2	UTSW	14	122,716,369 (GRCm39)	missense	probably damaging	0.99
R0027:Zic2	UTSW	14	122,713,755 (GRCm39)	missense	possibly damaging	0.77
R0136:Zic2	UTSW	14	122,713,953 (GRCm39)	missense	probably damaging	0.96
R0310:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0418:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0421:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0518:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0520:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0521:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0628:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R1733:Zic2	UTSW	14	122,716,359 (GRCm39)	missense	probably damaging	0.97
R1757:Zic2	UTSW	14	122,716,031 (GRCm39)	missense	possibly damaging	0.86
R2398:Zic2	UTSW	14	122,716,329 (GRCm39)	nonsense	probably null
R5323:Zic2	UTSW	14	122,713,728 (GRCm39)	missense	probably damaging	1.00
R5381:Zic2	UTSW	14	122,713,227 (GRCm39)	missense	probably damaging	0.97
R6930:Zic2	UTSW	14	122,713,869 (GRCm39)	missense	probably damaging	0.99
R7223:Zic2	UTSW	14	122,713,503 (GRCm39)	missense	probably damaging	0.98
R8750:Zic2	UTSW	14	122,714,129 (GRCm39)	missense	probably benign	0.06
R8852:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
R8860:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
Z1088:Zic2	UTSW	14	122,716,087 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

Posted On

2013-08-19