Incidental Mutation 'R0268:Gls'
ID66358
Institutional Source Beutler Lab
Gene Symbol Gls
Ensembl Gene ENSMUSG00000026103
Gene Nameglutaminase
Synonyms
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0268 (G1)
Quality Score102
Status Not validated
Chromosome1
Chromosomal Location52163448-52233232 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) GGCTGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTGCTG at 52232694 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114510] [ENSMUST00000114512] [ENSMUST00000114513]
Predicted Effect probably benign
Transcript: ENSMUST00000114510
SMART Domains Protein: ENSMUSP00000110155
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 3e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114512
SMART Domains Protein: ENSMUSP00000110157
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 66 352 1.7e-125 PFAM
ANK 407 437 3.9e-6 SMART
ANK 441 470 3.6e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114513
SMART Domains Protein: ENSMUSP00000110158
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 4.2e-123 PFAM
ANK 590 620 6.02e-4 SMART
ANK 624 653 5.69e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142976
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die within 1 day postnatally with abnormal respiratory function and goal-oriented behavior toward dam. Mice homozygous for another allele exhibit abnormal TNFA-stimulated astrocyte extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Gls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Gls APN 1 52188708 missense probably damaging 1.00
IGL01366:Gls APN 1 52168399 missense probably damaging 1.00
IGL01367:Gls APN 1 52168399 missense probably damaging 1.00
IGL01832:Gls APN 1 52168409 splice site probably null
IGL02045:Gls APN 1 52219515 missense probably benign 0.01
LCD18:Gls UTSW 1 52183367 intron probably benign
R0373:Gls UTSW 1 52188699 missense probably damaging 1.00
R0590:Gls UTSW 1 52212375 unclassified probably benign
R1440:Gls UTSW 1 52191134 missense possibly damaging 0.59
R1628:Gls UTSW 1 52232676 missense probably benign 0.06
R3684:Gls UTSW 1 52166293 missense probably damaging 1.00
R3697:Gls UTSW 1 52199764 missense possibly damaging 0.65
R3778:Gls UTSW 1 52168912 missense probably benign 0.05
R3824:Gls UTSW 1 52232988 missense possibly damaging 0.83
R4062:Gls UTSW 1 52196748 missense probably damaging 1.00
R4441:Gls UTSW 1 52196163 critical splice donor site probably null
R4740:Gls UTSW 1 52232788 missense probably damaging 0.99
R4816:Gls UTSW 1 52199945 intron probably benign
R5281:Gls UTSW 1 52191157 missense probably damaging 1.00
R5712:Gls UTSW 1 52196752 missense probably damaging 1.00
R6163:Gls UTSW 1 52215576 missense probably benign 0.00
R6357:Gls UTSW 1 52219506 missense probably damaging 0.99
R6498:Gls UTSW 1 52220039 missense probably benign
Predicted Primers
Posted On2013-08-19