Incidental Mutation 'R0068:Mroh2a'
ID67059
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R0068 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GT to GTT at 88256166 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]
Predicted Effect probably null
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135948
SMART Domains Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
SCOP:d1gw5a_ 15 174 5e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGCATTTAACTGACACCCCTGCC -3'
(R):5'- TGCAGAACTGGGTCGCTCATGAAC -3'

Sequencing Primer
(F):5'- GCTAAGAAGTCTGATTCAGTCCC -3'
(R):5'- TGCAGTTACCCAGGATGTCAG -3'
Posted On2013-08-20