Incidental Mutation 'R0733:Sun1'
ID67100
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene NameSad1 and UNC84 domain containing 1
SynonymsUnc84a, 5730434D03Rik, 4632417G13Rik
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0733 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139200637-139249840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139231163 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 255 (H255R)
Ref Sequence ENSEMBL: ENSMUSP00000077756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000100517] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000135720] [ENSMUST00000143562] [ENSMUST00000146715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058716
AA Change: H319R

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: H319R

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078690
AA Change: H255R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: H255R

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100517
SMART Domains Protein: ENSMUSP00000098086
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110882
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110883
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110884
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126108
Predicted Effect probably benign
Transcript: ENSMUST00000128817
SMART Domains Protein: ENSMUSP00000119587
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
coiled coil region 58 126 N/A INTRINSIC
PDB:4DXS|A 207 258 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135720
SMART Domains Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
ZnF_C2H2 98 120 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142473
Predicted Effect probably benign
Transcript: ENSMUST00000143562
SMART Domains Protein: ENSMUSP00000116364
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 158 7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146715
SMART Domains Protein: ENSMUSP00000117679
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 160 4.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153469
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139234685 critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139234741 missense probably damaging 1.00
IGL02142:Sun1 APN 5 139231163 missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139241431 missense probably damaging 1.00
IGL02939:Sun1 APN 5 139235488 splice site probably benign
IGL03253:Sun1 APN 5 139223586 splice site probably benign
IGL03370:Sun1 APN 5 139231131 missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139226588 missense probably damaging 0.97
R0124:Sun1 UTSW 5 139246679 unclassified probably benign
R0145:Sun1 UTSW 5 139241411 missense probably damaging 0.98
R0376:Sun1 UTSW 5 139226699 unclassified probably benign
R0512:Sun1 UTSW 5 139234847 splice site probably benign
R0729:Sun1 UTSW 5 139237864 unclassified probably benign
R1188:Sun1 UTSW 5 139238856 missense probably damaging 0.98
R1724:Sun1 UTSW 5 139235725 missense probably benign
R1733:Sun1 UTSW 5 139230789 missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139235732 critical splice donor site probably null
R2033:Sun1 UTSW 5 139225438 missense probably damaging 1.00
R2200:Sun1 UTSW 5 139231219 missense probably benign 0.11
R3084:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3085:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3771:Sun1 UTSW 5 139238820 unclassified probably benign
R3772:Sun1 UTSW 5 139238820 unclassified probably benign
R3804:Sun1 UTSW 5 139225362 nonsense probably null
R4300:Sun1 UTSW 5 139227594 unclassified probably benign
R4428:Sun1 UTSW 5 139234475 intron probably benign
R4993:Sun1 UTSW 5 139225333 missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139226891 splice site probably null
R5363:Sun1 UTSW 5 139234743 missense probably damaging 1.00
R5826:Sun1 UTSW 5 139245416 missense probably damaging 1.00
R6753:Sun1 UTSW 5 139215259 splice site probably null
R7218:Sun1 UTSW 5 139226687 missense unknown
R7320:Sun1 UTSW 5 139248484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGAACAGCCCACCCTAGCTTATG -3'
(R):5'- CCTATAGTGCTTTCTGACACTGGCAG -3'

Sequencing Primer
(F):5'- AGCTTATGGCTTCACTGGC -3'
(R):5'- TGGCAGTGTAAATAAACCAAACACAG -3'
Posted On2013-09-03