Incidental Mutation 'R0733:Apba2'
ID67107
Institutional Source Beutler Lab
Gene Symbol Apba2
Ensembl Gene ENSMUSG00000030519
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 2
SynonymsX11L, X11-like, Mint 2
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0733 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64501706-64753878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64750164 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 689 (I689T)
Ref Sequence ENSEMBL: ENSMUSP00000146038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]
Predicted Effect probably damaging
Transcript: ENSMUST00000032732
AA Change: I701T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: I701T

DomainStartEndE-ValueType
low complexity region 82 96 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
PTB 368 534 6.31e-29 SMART
PDZ 578 656 6.32e-12 SMART
PDZ 670 736 1.79e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206061
Predicted Effect probably damaging
Transcript: ENSMUST00000206246
AA Change: I689T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206630
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Apba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Apba2 APN 7 64736941 missense possibly damaging 0.79
IGL01716:Apba2 APN 7 64745826 splice site probably benign
IGL02218:Apba2 APN 7 64695677 missense probably benign 0.01
IGL02343:Apba2 APN 7 64695146 missense probably damaging 0.96
IGL03265:Apba2 APN 7 64695323 missense probably damaging 1.00
guadalupe UTSW 7 64750164 missense probably damaging 1.00
LCD18:Apba2 UTSW 7 64622160 intron probably benign
R0395:Apba2 UTSW 7 64743408 missense probably benign 0.00
R0554:Apba2 UTSW 7 64745780 missense probably damaging 1.00
R0624:Apba2 UTSW 7 64714515 splice site probably null
R1107:Apba2 UTSW 7 64745719 missense possibly damaging 0.51
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1486:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R1895:Apba2 UTSW 7 64744630 critical splice donor site probably null
R1942:Apba2 UTSW 7 64695470 missense possibly damaging 0.92
R1946:Apba2 UTSW 7 64744630 critical splice donor site probably null
R2002:Apba2 UTSW 7 64733542 missense probably damaging 0.97
R2089:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2571:Apba2 UTSW 7 64745750 missense probably damaging 0.98
R3035:Apba2 UTSW 7 64739792 missense probably benign 0.03
R4620:Apba2 UTSW 7 64714467 missense probably damaging 1.00
R5468:Apba2 UTSW 7 64745762 missense probably damaging 1.00
R5478:Apba2 UTSW 7 64695186 nonsense probably null
R5644:Apba2 UTSW 7 64715511 missense probably benign
R5645:Apba2 UTSW 7 64695806 missense possibly damaging 0.92
R5941:Apba2 UTSW 7 64745716 missense probably benign 0.03
R5969:Apba2 UTSW 7 64744447 nonsense probably null
R6190:Apba2 UTSW 7 64739880 missense probably damaging 0.98
R6806:Apba2 UTSW 7 64695459 missense probably damaging 1.00
R7098:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R7143:Apba2 UTSW 7 64744417 missense probably damaging 1.00
R7183:Apba2 UTSW 7 64733545 missense probably benign 0.11
R7260:Apba2 UTSW 7 64739745 missense probably damaging 1.00
R7479:Apba2 UTSW 7 64739859 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACACAATGGTGCTGGCTCCTCTTC -3'
(R):5'- AAGTGGGGCACACCCATGAAAC -3'

Sequencing Primer
(F):5'- TCATGAGTCAGGGACTGAAATGC -3'
(R):5'- GGACCAGTGGCTTTTCAAAAC -3'
Posted On2013-09-03