Mutagenetix > Incidental Mutation

Incidental Mutation 'T0970:Septin4'

67267

Institutional Source

Beutler Lab

Gene Symbol

Septin4

Ensembl Gene

ENSMUSG00000020486

Gene Name

septin 4

Synonyms

Gm11492, ARTS, septin H5, cell division control-related protein 2b, Sept4, Bh5, Pnutl2

Accession Numbers

Essential gene?

Probably essential (E-score: 0.768) question?

Stock #

T0970 (G3) of strain 713

Quality Score

181

Status

Validated

Chromosome

Chromosomal Location

87457515-87481365 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87458558 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 311 (T311S)

Ref Sequence

ENSEMBL: ENSMUSP00000053087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]

AlphaFold

P28661
Q5ND19

Predicted Effect

probably damaging
Transcript: ENSMUST00000060360
AA Change: T311S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: T311S

Domain	Start	End	E-Value	Type
Pfam:DUF4655	13	369	1.7e-99	PFAM
Pfam:DUF4655	366	509	2.7e-68	PFAM
low complexity region	511	536	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122945

SMART Domains

Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

Domain	Start	End	E-Value	Type
low complexity region	87	101	N/A	INTRINSIC
Pfam:DUF258	116	212	2.4e-7	PFAM
Pfam:Septin	134	213	9.1e-31	PFAM
Pfam:MMR_HSR1	139	213	5.5e-7	PFAM

Meta Mutation Damage Score

0.0792

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.3%
20x: 94.7%

Validation Efficiency

100% (25/25)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano4	A	T	10: 88,817,052 (GRCm39)	L591*	probably null	Het
Aqp4	A	G	18: 15,532,940 (GRCm39)	L51P	probably damaging	Het
Cemip	A	T	7: 83,632,354 (GRCm39)	C403S	probably damaging	Het
Cfap74	G	T	4: 155,547,574 (GRCm39)		probably null	Het
Glis3	G	A	19: 28,508,332 (GRCm39)	R551W	probably damaging	Het
Gm11232	T	A	4: 71,674,740 (GRCm39)	Y254F	possibly damaging	Het
Map3k14	G	T	11: 103,115,124 (GRCm39)	C837*	probably null	Het
Mrc2	A	C	11: 105,238,453 (GRCm39)	E1200A	probably benign	Het
Nfix	T	C	8: 85,453,112 (GRCm39)	N314S	possibly damaging	Het
Nphp4	T	C	4: 152,640,836 (GRCm39)	S1068P	probably damaging	Het
Nup98	A	C	7: 101,835,959 (GRCm39)		probably benign	Het
Or13p8	A	G	4: 118,583,464 (GRCm39)	R7G	probably benign	Het
Pcdhac2	T	C	18: 37,278,388 (GRCm39)	V456A	possibly damaging	Het
Pcdhb1	G	T	18: 37,399,026 (GRCm39)	G326C	probably damaging	Het
Prss38	A	G	11: 59,263,974 (GRCm39)	V246A	possibly damaging	Het
Rnf26	C	G	9: 44,023,369 (GRCm39)	R172P	probably damaging	Het
Serinc3	TATCATC	TATC	2: 163,469,835 (GRCm39)		probably benign	Het
Spire1	C	A	18: 67,634,133 (GRCm39)		probably null	Het
Tex2	T	A	11: 106,437,772 (GRCm39)	I633F	unknown	Het
Tle2	A	G	10: 81,416,119 (GRCm39)	D108G	possibly damaging	Het
Txnrd2	T	C	16: 18,260,523 (GRCm39)	V185A	probably damaging	Het
Unc45b	C	A	11: 82,813,714 (GRCm39)	H374N	probably benign	Het
Wtap	T	C	17: 13,188,277 (GRCm39)		probably benign	Het

Other mutations in Septin4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00941:Septin4	APN	11	87,480,599 (GRCm39)	missense	probably damaging	1.00
IGL00963:Septin4	APN	11	87,474,199 (GRCm39)	missense	possibly damaging	0.89
IGL01803:Septin4	APN	11	87,459,075 (GRCm39)	missense	probably benign	0.07
IGL01993:Septin4	APN	11	87,458,555 (GRCm39)	missense	possibly damaging	0.85
IGL02566:Septin4	APN	11	87,458,468 (GRCm39)	missense	probably benign	0.00
IGL03087:Septin4	APN	11	87,476,071 (GRCm39)	splice site	probably benign
IGL03213:Septin4	APN	11	87,458,184 (GRCm39)	splice site	probably null
IGL03268:Septin4	APN	11	87,480,529 (GRCm39)	missense	probably damaging	0.99
IGL03388:Septin4	APN	11	87,459,042 (GRCm39)	nonsense	probably null
R0050:Septin4	UTSW	11	87,458,172 (GRCm39)	missense	probably damaging	1.00
R0077:Septin4	UTSW	11	87,472,022 (GRCm39)	missense	probably benign
R1479:Septin4	UTSW	11	87,458,244 (GRCm39)	missense	probably damaging	1.00
R1729:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R1730:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R1739:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R1762:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R1783:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R1784:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R1785:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R1851:Septin4	UTSW	11	87,459,741 (GRCm39)	missense	probably damaging	1.00
R1862:Septin4	UTSW	11	87,458,061 (GRCm39)	missense	possibly damaging	0.48
R1913:Septin4	UTSW	11	87,457,838 (GRCm39)	missense	probably benign
R1957:Septin4	UTSW	11	87,481,193 (GRCm39)	missense	probably benign	0.02
R2131:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R2133:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R2140:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R2141:Septin4	UTSW	11	87,474,262 (GRCm39)	missense	probably benign	0.26
R2252:Septin4	UTSW	11	87,480,637 (GRCm39)	missense	possibly damaging	0.75
R3149:Septin4	UTSW	11	87,458,070 (GRCm39)	missense	possibly damaging	0.46
R3176:Septin4	UTSW	11	87,458,070 (GRCm39)	missense	possibly damaging	0.46
R3276:Septin4	UTSW	11	87,458,070 (GRCm39)	missense	possibly damaging	0.46
R3696:Septin4	UTSW	11	87,476,060 (GRCm39)	missense	possibly damaging	0.48
R4018:Septin4	UTSW	11	87,475,947 (GRCm39)	missense	probably damaging	1.00
R4021:Septin4	UTSW	11	87,458,106 (GRCm39)	missense	probably damaging	1.00
R4117:Septin4	UTSW	11	87,459,108 (GRCm39)	missense	probably damaging	1.00
R4193:Septin4	UTSW	11	87,474,142 (GRCm39)	critical splice acceptor site	probably null
R4196:Septin4	UTSW	11	87,479,598 (GRCm39)	missense	probably damaging	0.96
R4332:Septin4	UTSW	11	87,458,730 (GRCm39)	missense	possibly damaging	0.95
R4515:Septin4	UTSW	11	87,458,883 (GRCm39)	missense	probably benign
R4663:Septin4	UTSW	11	87,458,429 (GRCm39)	missense	probably damaging	0.98
R4952:Septin4	UTSW	11	87,458,598 (GRCm39)	missense	probably benign	0.00
R5012:Septin4	UTSW	11	87,475,230 (GRCm39)	missense	possibly damaging	0.78
R5015:Septin4	UTSW	11	87,458,043 (GRCm39)	missense	possibly damaging	0.95
R5149:Septin4	UTSW	11	87,480,071 (GRCm39)	missense	probably damaging	1.00
R5176:Septin4	UTSW	11	87,458,358 (GRCm39)	missense	probably benign	0.02
R5711:Septin4	UTSW	11	87,458,723 (GRCm39)	missense	probably benign	0.07
R5891:Septin4	UTSW	11	87,479,750 (GRCm39)	unclassified	probably benign
R6090:Septin4	UTSW	11	87,480,343 (GRCm39)	missense	possibly damaging	0.48
R6145:Septin4	UTSW	11	87,476,072 (GRCm39)	splice site	probably null
R6257:Septin4	UTSW	11	87,481,175 (GRCm39)	missense	probably benign	0.07
R6305:Septin4	UTSW	11	87,458,145 (GRCm39)	missense	probably benign	0.00
R6704:Septin4	UTSW	11	87,479,856 (GRCm39)	missense	probably damaging	1.00
R7064:Septin4	UTSW	11	87,481,193 (GRCm39)	missense	probably benign	0.02
R7090:Septin4	UTSW	11	87,475,264 (GRCm39)	missense	probably damaging	1.00
R7784:Septin4	UTSW	11	87,469,834 (GRCm39)	missense	probably benign
R7790:Septin4	UTSW	11	87,480,065 (GRCm39)	missense	probably damaging	1.00
R8320:Septin4	UTSW	11	87,480,560 (GRCm39)	missense	possibly damaging	0.68
R9289:Septin4	UTSW	11	87,459,792 (GRCm39)	nonsense	probably null
R9613:Septin4	UTSW	11	87,469,823 (GRCm39)	missense	possibly damaging	0.53
Z1177:Septin4	UTSW	11	87,458,748 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCATGGCATTCGCATGGCTAATAAC -3'
(R):5'- CGAGGAGTCAACTCAAATGCTGAGG -3'

Sequencing Primer
(F):5'- GATAGTCATTAGAAAGGTCCCTCC -3'
(R):5'- CTTTGTTGAAAGCTCTGGATACAG -3'

Posted On

2013-09-03