Incidental Mutation 'T0970:Map3k14'
ID67268
Institutional Source Beutler Lab
Gene Symbol Map3k14
Ensembl Gene ENSMUSG00000020941
Gene Namemitogen-activated protein kinase kinase kinase 14
SynonymsNik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #T0970 (G3) of strain 713
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103219762-103267472 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 103224298 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 837 (C837*)
Ref Sequence ENSEMBL: ENSMUSP00000021324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021324]
PDB Structure
Crystal structure of apo murine Nf-kappaB inducing kinase (NIK) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 6-alkynylindoline (cmp1) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 2-(aminothiazoly)phenol (cmp2) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) V408L bound to a 2-(aminothiazolyl)phenol (cmp3) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000021324
AA Change: C837*
SMART Domains Protein: ENSMUSP00000021324
Gene: ENSMUSG00000020941
AA Change: C837*

DomainStartEndE-ValueType
low complexity region 134 153 N/A INTRINSIC
Pfam:Pkinase 402 653 2.1e-42 PFAM
Pfam:Pkinase_Tyr 402 653 1.5e-24 PFAM
low complexity region 706 719 N/A INTRINSIC
low complexity region 760 774 N/A INTRINSIC
low complexity region 789 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146163
Meta Mutation Damage Score 0.6376 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes mitogen-activated protein kinase kinase kinase 14, which is a serine/threonine protein-kinase. This kinase binds to TRAF2 and stimulates NF-kappaB activity. It shares sequence similarity with several other MAPKK kinases. It participates in an NF-kappaB-inducing signalling cascade common to receptors of the tumour-necrosis/nerve-growth factor (TNF/NGF) family and to the interleukin-1 type-I receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit deficiencies in cellular and humoral immunity, susceptibility to infections, absence of lymph nodes and Peyer's patches, failure of isotype switching, and inflammation of exocrine organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L626* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably benign Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 noncoding transcript Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Rnf26 C G 9: 44,112,072 R293P probably damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Map3k14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Map3k14 APN 11 103227579 missense probably damaging 1.00
IGL00590:Map3k14 APN 11 103237554 missense probably damaging 1.00
IGL03065:Map3k14 APN 11 103225101 missense probably damaging 1.00
lucky UTSW 11 103249558 nonsense
R0020:Map3k14 UTSW 11 103227674 missense probably damaging 0.99
R0070:Map3k14 UTSW 11 103239554 critical splice acceptor site probably null
R0294:Map3k14 UTSW 11 103227137 missense possibly damaging 0.80
R0624:Map3k14 UTSW 11 103242291 missense possibly damaging 0.77
R0734:Map3k14 UTSW 11 103227000 missense probably benign 0.00
R1015:Map3k14 UTSW 11 103225300 missense probably damaging 1.00
R1170:Map3k14 UTSW 11 103238917 splice site noncoding transcript
R1487:Map3k14 UTSW 11 103225337 missense possibly damaging 0.48
R2204:Map3k14 UTSW 11 103239454 missense possibly damaging 0.82
R2880:Map3k14 UTSW 11 103221032 missense probably damaging 1.00
R4429:Map3k14 UTSW 11 103227584 missense probably damaging 1.00
R4624:Map3k14 UTSW 11 103231101 missense probably damaging 1.00
R4967:Map3k14 UTSW 11 103239531 missense probably benign 0.00
R5098:Map3k14 UTSW 11 103224359 missense probably damaging 1.00
R5148:Map3k14 UTSW 11 103239332 missense probably benign
R5208:Map3k14 UTSW 11 103239146 missense probably damaging 0.98
R5480:Map3k14 UTSW 11 103239504 missense probably benign 0.03
X0023:Map3k14 UTSW 11 103239822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTAGGTATTCAGCTTCTGGCCC -3'
(R):5'- AGCGGTAGCTTTGGTCCCACATAG -3'

Sequencing Primer
(F):5'- TCTACAGGCAGCCAATTTGGAG -3'
(R):5'- GGTCCCACATAGAAATGTACCTTG -3'
Posted OnSep 03, 2013