Incidental Mutation 'T0970:Spire1'
ID 67274
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Name spire type actin nucleation factor 1
Synonyms 6030430B19Rik, Spir-1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # T0970 (G3) of strain 713
Quality Score 88
Status Validated
Chromosome 18
Chromosomal Location 67621279-67743860 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to A at 67634133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
AlphaFold Q52KF3
Predicted Effect probably null
Transcript: ENSMUST00000045105
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082243
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115050
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224659
Predicted Effect probably benign
Transcript: ENSMUST00000224799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226000
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,817,052 (GRCm39) L591* probably null Het
Aqp4 A G 18: 15,532,940 (GRCm39) L51P probably damaging Het
Cemip A T 7: 83,632,354 (GRCm39) C403S probably damaging Het
Cfap74 G T 4: 155,547,574 (GRCm39) probably null Het
Glis3 G A 19: 28,508,332 (GRCm39) R551W probably damaging Het
Gm11232 T A 4: 71,674,740 (GRCm39) Y254F possibly damaging Het
Map3k14 G T 11: 103,115,124 (GRCm39) C837* probably null Het
Mrc2 A C 11: 105,238,453 (GRCm39) E1200A probably benign Het
Nfix T C 8: 85,453,112 (GRCm39) N314S possibly damaging Het
Nphp4 T C 4: 152,640,836 (GRCm39) S1068P probably damaging Het
Nup98 A C 7: 101,835,959 (GRCm39) probably benign Het
Or13p8 A G 4: 118,583,464 (GRCm39) R7G probably benign Het
Pcdhac2 T C 18: 37,278,388 (GRCm39) V456A possibly damaging Het
Pcdhb1 G T 18: 37,399,026 (GRCm39) G326C probably damaging Het
Prss38 A G 11: 59,263,974 (GRCm39) V246A possibly damaging Het
Rnf26 C G 9: 44,023,369 (GRCm39) R172P probably damaging Het
Septin4 A T 11: 87,458,558 (GRCm39) T311S probably damaging Het
Serinc3 TATCATC TATC 2: 163,469,835 (GRCm39) probably benign Het
Tex2 T A 11: 106,437,772 (GRCm39) I633F unknown Het
Tle2 A G 10: 81,416,119 (GRCm39) D108G possibly damaging Het
Txnrd2 T C 16: 18,260,523 (GRCm39) V185A probably damaging Het
Unc45b C A 11: 82,813,714 (GRCm39) H374N probably benign Het
Wtap T C 17: 13,188,277 (GRCm39) probably benign Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67,662,085 (GRCm39) missense probably damaging 1.00
IGL01639:Spire1 APN 18 67,678,738 (GRCm39) missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67,639,725 (GRCm39) missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67,624,435 (GRCm39) missense probably damaging 1.00
R0457:Spire1 UTSW 18 67,685,670 (GRCm39) missense probably damaging 0.98
R0531:Spire1 UTSW 18 67,624,375 (GRCm39) missense probably damaging 1.00
R0608:Spire1 UTSW 18 67,661,945 (GRCm39) missense probably damaging 0.99
R2098:Spire1 UTSW 18 67,636,536 (GRCm39) missense probably damaging 0.99
R2299:Spire1 UTSW 18 67,663,493 (GRCm39) missense probably damaging 1.00
R3028:Spire1 UTSW 18 67,624,417 (GRCm39) missense probably damaging 1.00
R3815:Spire1 UTSW 18 67,639,733 (GRCm39) missense probably benign 0.05
R4049:Spire1 UTSW 18 67,662,101 (GRCm39) splice site probably null
R4050:Spire1 UTSW 18 67,662,101 (GRCm39) splice site probably null
R4059:Spire1 UTSW 18 67,678,783 (GRCm39) missense probably damaging 0.98
R4109:Spire1 UTSW 18 67,630,287 (GRCm39) missense probably damaging 1.00
R4700:Spire1 UTSW 18 67,645,935 (GRCm39) missense probably benign 0.01
R4941:Spire1 UTSW 18 67,652,384 (GRCm39) missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67,685,849 (GRCm39) splice site probably null
R5363:Spire1 UTSW 18 67,639,625 (GRCm39) missense probably damaging 1.00
R5561:Spire1 UTSW 18 67,639,716 (GRCm39) missense probably damaging 0.96
R5795:Spire1 UTSW 18 67,628,265 (GRCm39) missense probably benign
R5952:Spire1 UTSW 18 67,639,779 (GRCm39) missense probably benign 0.00
R5982:Spire1 UTSW 18 67,630,386 (GRCm39) critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67,652,950 (GRCm39) missense probably damaging 1.00
R7559:Spire1 UTSW 18 67,634,187 (GRCm39) missense probably benign 0.04
R8006:Spire1 UTSW 18 67,634,251 (GRCm39) nonsense probably null
R8111:Spire1 UTSW 18 67,652,391 (GRCm39) missense probably damaging 0.98
R8675:Spire1 UTSW 18 67,624,378 (GRCm39) missense possibly damaging 0.48
R8946:Spire1 UTSW 18 67,629,686 (GRCm39) missense probably damaging 1.00
R9441:Spire1 UTSW 18 67,652,462 (GRCm39) missense probably benign 0.41
R9706:Spire1 UTSW 18 67,636,508 (GRCm39) missense probably benign 0.39
Z1088:Spire1 UTSW 18 67,628,222 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCCCTGGTGAGAAAGCATGAGTC -3'
(R):5'- TGTAGCCATGAACCATTGCCATCC -3'

Sequencing Primer
(F):5'- CACAGGCTCTCTAGCTGATG -3'
(R):5'- TGCAGGTCACTTGTTCAGC -3'
Posted On 2013-09-03