Incidental Mutation 'R0736:Zw10'
ID67296
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
MMRRC Submission 038917-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0736 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49064132 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 286 (H286Y)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803]
Predicted Effect probably benign
Transcript: ENSMUST00000034803
AA Change: H286Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: H286Y

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215706
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,441,745 S702C probably damaging Het
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
BC027072 A G 17: 71,744,664 V1231A probably benign Het
Cacna2d3 A T 14: 29,058,628 H644Q probably benign Het
Calb1 G A 4: 15,898,917 V138M probably benign Het
Cep55 C A 19: 38,073,317 T402N probably benign Het
Chrnb3 G A 8: 27,385,050 A26T probably benign Het
Col6a3 C T 1: 90,804,089 V1481I possibly damaging Het
Dmxl2 C T 9: 54,378,817 V2695I probably damaging Het
Heatr5a A C 12: 51,896,561 probably null Het
Kmt2c C T 5: 25,295,434 M461I probably benign Het
Mapk9 G A 11: 49,883,254 D413N possibly damaging Het
Morc4 G T X: 139,854,951 Q239K probably benign Het
Myt1l T A 12: 29,827,814 V488D unknown Het
Neb A T 2: 52,192,012 Y24N probably damaging Het
Neo1 G A 9: 58,917,081 P688L possibly damaging Het
Nlrp9b A T 7: 20,049,450 D409V probably damaging Het
Pde7a T C 3: 19,231,043 N327D probably damaging Het
Pdzd8 C A 19: 59,344,933 V219L probably damaging Het
Pgc T A 17: 47,728,780 M33K probably damaging Het
Pik3ap1 T A 19: 41,332,319 T154S possibly damaging Het
Polm G C 11: 5,835,495 S188C possibly damaging Het
Slfn1 A T 11: 83,121,081 T8S probably benign Het
St8sia6 C T 2: 13,668,885 V179M probably benign Het
Tns3 A T 11: 8,519,474 F274I possibly damaging Het
Tspan5 T C 3: 138,868,398 probably null Het
Utp14b A G 1: 78,665,272 K296E probably damaging Het
Zbtb14 A G 17: 69,387,802 E165G possibly damaging Het
Zbtb17 C A 4: 141,461,786 H6N probably damaging Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 unclassified probably null
PIT4382001:Zw10 UTSW 9 49071644 missense probably benign 0.15
R0402:Zw10 UTSW 9 49068723 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2231:Zw10 UTSW 9 49064121 missense possibly damaging 0.79
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5637:Zw10 UTSW 9 49057650 missense probably damaging 1.00
R5983:Zw10 UTSW 9 49077445 unclassified probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTGTTGATGAGTGTCCCCAT -3'
(R):5'- GGCTCTGAGATGTCACTAATGACCCAA -3'

Sequencing Primer
(F):5'- GAAAGGCAGCCAAGTTCAGT -3'
(R):5'- CTACTGTGTTCCTAAGGCGAGAC -3'
Posted On2013-09-03