Mutagenetix > Incidental Mutation

Incidental Mutation 'R0736:Mapk9'

67301

Institutional Source

Beutler Lab

Gene Symbol

Mapk9

Ensembl Gene

ENSMUSG00000020366

Gene Name

mitogen-activated protein kinase 9

Synonyms

c-Jun N-terminal kinase, Prkm9, JNK2, JNK/SAPK alpha

MMRRC Submission

038917-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R0736 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49737578-49777248 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 49774081 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 413 (D413N)

Ref Sequence

ENSEMBL: ENSMUSP00000136977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020634] [ENSMUST00000043321] [ENSMUST00000102778] [ENSMUST00000109178] [ENSMUST00000109179] [ENSMUST00000164643] [ENSMUST00000178543]

AlphaFold

Q9WTU6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020634
AA Change: D413N

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020634
Gene: ENSMUSG00000020366
AA Change: D413N

Domain	Start	End	E-Value	Type
S_TKc	26	321	4.01e-87	SMART
low complexity region	387	399	N/A	INTRINSIC
low complexity region	403	416	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043321
AA Change: D413N

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000042744
Gene: ENSMUSG00000020366
AA Change: D413N

Domain	Start	End	E-Value	Type
S_TKc	26	321	7.6e-88	SMART
low complexity region	387	399	N/A	INTRINSIC
low complexity region	403	416	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102778

SMART Domains

Protein: ENSMUSP00000099839
Gene: ENSMUSG00000020366

Domain	Start	End	E-Value	Type
S_TKc	26	321	7.6e-88	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109178

SMART Domains

Protein: ENSMUSP00000104807
Gene: ENSMUSG00000020366

Domain	Start	End	E-Value	Type
S_TKc	26	321	4.01e-87	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109179

SMART Domains

Protein: ENSMUSP00000104808
Gene: ENSMUSG00000020366

Domain	Start	End	E-Value	Type
S_TKc	26	321	7.6e-88	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164643

SMART Domains

Protein: ENSMUSP00000132864
Gene: ENSMUSG00000020366

Domain	Start	End	E-Value	Type
S_TKc	26	321	4.01e-87	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178543
AA Change: D413N

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000136977
Gene: ENSMUSG00000020366
AA Change: D413N

Domain	Start	End	E-Value	Type
S_TKc	26	321	7.6e-88	SMART
low complexity region	387	399	N/A	INTRINSIC
low complexity region	403	416	N/A	INTRINSIC

Coding Region Coverage

1x: 99.6%
3x: 99.0%
10x: 97.6%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a null allele show resistance to TNF-induced liver injury, impaired TH1 cell differentiation, and enhanced epidermal differentiation and proliferation. Homozygotes for a reporter allele show impaired T-cell activation and apoptosis, resistance to I-R cardiac injury, and reduced LTP. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amn1	G	A	6: 149,084,970 (GRCm39)	H37Y	possibly damaging	Het
Cacna2d3	A	T	14: 28,780,585 (GRCm39)	H644Q	probably benign	Het
Calb1	G	A	4: 15,898,917 (GRCm39)	V138M	probably benign	Het
Cep55	C	A	19: 38,061,765 (GRCm39)	T402N	probably benign	Het
Chrnb3	G	A	8: 27,875,078 (GRCm39)	A26T	probably benign	Het
Col6a3	C	T	1: 90,731,811 (GRCm39)	V1481I	possibly damaging	Het
Dmxl2	C	T	9: 54,286,101 (GRCm39)	V2695I	probably damaging	Het
Elapor2	A	T	5: 9,491,745 (GRCm39)	S702C	probably damaging	Het
Heatr5a	A	C	12: 51,943,344 (GRCm39)		probably null	Het
Kmt2c	C	T	5: 25,500,432 (GRCm39)	M461I	probably benign	Het
Morc4	G	T	X: 138,755,700 (GRCm39)	Q239K	probably benign	Het
Myt1l	T	A	12: 29,877,813 (GRCm39)	V488D	unknown	Het
Neb	A	T	2: 52,082,024 (GRCm39)	Y24N	probably damaging	Het
Neo1	G	A	9: 58,824,364 (GRCm39)	P688L	possibly damaging	Het
Nlrp9b	A	T	7: 19,783,375 (GRCm39)	D409V	probably damaging	Het
Pcare	A	G	17: 72,051,659 (GRCm39)	V1231A	probably benign	Het
Pde7a	T	C	3: 19,285,207 (GRCm39)	N327D	probably damaging	Het
Pdzd8	C	A	19: 59,333,365 (GRCm39)	V219L	probably damaging	Het
Pgc	T	A	17: 48,039,705 (GRCm39)	M33K	probably damaging	Het
Pik3ap1	T	A	19: 41,320,758 (GRCm39)	T154S	possibly damaging	Het
Polm	G	C	11: 5,785,495 (GRCm39)	S188C	possibly damaging	Het
Slfn1	A	T	11: 83,011,907 (GRCm39)	T8S	probably benign	Het
St8sia6	C	T	2: 13,673,696 (GRCm39)	V179M	probably benign	Het
Tns3	A	T	11: 8,469,474 (GRCm39)	F274I	possibly damaging	Het
Tspan5	T	C	3: 138,574,159 (GRCm39)		probably null	Het
Utp14b	A	G	1: 78,642,989 (GRCm39)	K296E	probably damaging	Het
Zbtb14	A	G	17: 69,694,797 (GRCm39)	E165G	possibly damaging	Het
Zbtb17	C	A	4: 141,189,097 (GRCm39)	H6N	probably damaging	Het
Zw10	C	T	9: 48,975,432 (GRCm39)	H286Y	probably benign	Het

Other mutations in Mapk9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03085:Mapk9	APN	11	49,757,865 (GRCm39)	missense	probably damaging	1.00
IGL03399:Mapk9	APN	11	49,774,126 (GRCm39)	utr 3 prime	probably benign
Infirm	UTSW	11	49,754,383 (GRCm39)	missense	probably damaging	1.00
R0003:Mapk9	UTSW	11	49,757,866 (GRCm39)	missense	possibly damaging	0.52
R0610:Mapk9	UTSW	11	49,754,400 (GRCm39)	missense	probably benign	0.00
R0676:Mapk9	UTSW	11	49,773,983 (GRCm39)	makesense	probably null
R0681:Mapk9	UTSW	11	49,760,072 (GRCm39)	missense	probably damaging	1.00
R1186:Mapk9	UTSW	11	49,769,096 (GRCm39)	missense	probably damaging	0.99
R1964:Mapk9	UTSW	11	49,745,160 (GRCm39)	missense	probably null	1.00
R2424:Mapk9	UTSW	11	49,754,499 (GRCm39)	missense	probably damaging	1.00
R4876:Mapk9	UTSW	11	49,745,152 (GRCm39)	missense	probably damaging	0.97
R6191:Mapk9	UTSW	11	49,754,383 (GRCm39)	missense	probably damaging	1.00
R7059:Mapk9	UTSW	11	49,757,874 (GRCm39)	splice site	probably null
R7484:Mapk9	UTSW	11	49,763,663 (GRCm39)	missense	probably damaging	0.97
R7951:Mapk9	UTSW	11	49,754,422 (GRCm39)	missense	probably damaging	1.00
R8834:Mapk9	UTSW	11	49,774,010 (GRCm39)	missense	probably damaging	1.00
R9104:Mapk9	UTSW	11	49,760,000 (GRCm39)	missense	probably damaging	1.00
R9158:Mapk9	UTSW	11	49,745,095 (GRCm39)	missense	probably benign	0.02
R9176:Mapk9	UTSW	11	49,763,565 (GRCm39)	nonsense	probably null
R9573:Mapk9	UTSW	11	49,769,239 (GRCm39)	missense	probably damaging	0.99
RF010:Mapk9	UTSW	11	49,745,083 (GRCm39)	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTTGGATGCTACGCAGACCTAAAC -3'
(R):5'- AATCCTACTGGAACTGAGCAGGGC -3'

Sequencing Primer
(F):5'- ACATGGTCTTATGTGACCACAGG -3'
(R):5'- GCAAGGCATCGTGTTTCTTAC -3'

Posted On

2013-09-03