Incidental Mutation 'R0736:Morc4'
ID67315
Institutional Source Beutler Lab
Gene Symbol Morc4
Ensembl Gene ENSMUSG00000031434
Gene Namemicrorchidia 4
Synonyms5630401M14Rik, Zcwcc2, 1600017G11Rik
MMRRC Submission 038917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0736 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location139821632-139871677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139854951 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 239 (Q239K)
Ref Sequence ENSEMBL: ENSMUSP00000084663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033811] [ENSMUST00000087401] [ENSMUST00000165274] [ENSMUST00000171896]
Predicted Effect probably benign
Transcript: ENSMUST00000033811
AA Change: Q239K

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033811
Gene: ENSMUSG00000031434
AA Change: Q239K

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
HATPase_c 45 138 8.17e0 SMART
low complexity region 356 366 N/A INTRINSIC
Pfam:zf-CW 421 468 8.1e-21 PFAM
low complexity region 478 491 N/A INTRINSIC
low complexity region 683 700 N/A INTRINSIC
coiled coil region 758 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087401
AA Change: Q239K

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084663
Gene: ENSMUSG00000031434
AA Change: Q239K

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
HATPase_c 45 138 8.17e0 SMART
low complexity region 356 366 N/A INTRINSIC
Pfam:zf-CW 422 467 1.6e-19 PFAM
low complexity region 478 491 N/A INTRINSIC
low complexity region 683 700 N/A INTRINSIC
coiled coil region 758 867 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113014
Predicted Effect unknown
Transcript: ENSMUST00000136415
AA Change: Q14K
SMART Domains Protein: ENSMUSP00000132730
Gene: ENSMUSG00000031434
AA Change: Q14K

DomainStartEndE-ValueType
low complexity region 132 142 N/A INTRINSIC
Pfam:zf-CW 198 243 7.9e-20 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
coiled coil region 533 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146914
Predicted Effect probably benign
Transcript: ENSMUST00000165274
SMART Domains Protein: ENSMUSP00000126149
Gene: ENSMUSG00000031434

DomainStartEndE-ValueType
HATPase_c 11 104 8.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167664
SMART Domains Protein: ENSMUSP00000132245
Gene: ENSMUSG00000031434

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
Pfam:zf-CW 157 202 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171896
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the four current members of the microrchidia (morc) gene family share an N-terminal ATPase-like ATP-binding region and a CW four-cysteine zinc-finger motif. The protein encoded by this gene also has a nuclear matrix binding domain and a two-stranded coiled-coil motif near its C-terminus. This gene is widely expressed at low levels in normal tissues and has elevated expression in placenta and testis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,441,745 S702C probably damaging Het
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
BC027072 A G 17: 71,744,664 V1231A probably benign Het
Cacna2d3 A T 14: 29,058,628 H644Q probably benign Het
Calb1 G A 4: 15,898,917 V138M probably benign Het
Cep55 C A 19: 38,073,317 T402N probably benign Het
Chrnb3 G A 8: 27,385,050 A26T probably benign Het
Col6a3 C T 1: 90,804,089 V1481I possibly damaging Het
Dmxl2 C T 9: 54,378,817 V2695I probably damaging Het
Heatr5a A C 12: 51,896,561 probably null Het
Kmt2c C T 5: 25,295,434 M461I probably benign Het
Mapk9 G A 11: 49,883,254 D413N possibly damaging Het
Myt1l T A 12: 29,827,814 V488D unknown Het
Neb A T 2: 52,192,012 Y24N probably damaging Het
Neo1 G A 9: 58,917,081 P688L possibly damaging Het
Nlrp9b A T 7: 20,049,450 D409V probably damaging Het
Pde7a T C 3: 19,231,043 N327D probably damaging Het
Pdzd8 C A 19: 59,344,933 V219L probably damaging Het
Pgc T A 17: 47,728,780 M33K probably damaging Het
Pik3ap1 T A 19: 41,332,319 T154S possibly damaging Het
Polm G C 11: 5,835,495 S188C possibly damaging Het
Slfn1 A T 11: 83,121,081 T8S probably benign Het
St8sia6 C T 2: 13,668,885 V179M probably benign Het
Tns3 A T 11: 8,519,474 F274I possibly damaging Het
Tspan5 T C 3: 138,868,398 probably null Het
Utp14b A G 1: 78,665,272 K296E probably damaging Het
Zbtb14 A G 17: 69,387,802 E165G possibly damaging Het
Zbtb17 C A 4: 141,461,786 H6N probably damaging Het
Zw10 C T 9: 49,064,132 H286Y probably benign Het
Other mutations in Morc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03113:Morc4 APN X 139857856 missense probably benign 0.14
IGL03355:Morc4 APN X 139849682 missense probably null 1.00
R1710:Morc4 UTSW X 139854530 missense probably damaging 1.00
X0018:Morc4 UTSW X 139840779 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCTCTTAGCAATCATCTGCGT -3'
(R):5'- TCCTTTGGAGTGGTAGTCAGGGAAA -3'

Sequencing Primer
(F):5'- GAAAAATCTTCATCCGGGGC -3'
(R):5'- TGGTAGTCAGGGAAAGAAACATAGC -3'
Posted On2013-09-03