Incidental Mutation 'T0722:Lims1'
ID67337
Institutional Source Beutler Lab
Gene Symbol Lims1
Ensembl Gene ENSMUSG00000019920
Gene NameLIM and senescent cell antigen-like domains 1
Synonyms4921524A02Rik, PINCH1, C430041B13Rik, Lims1l, 2310016J22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58323466-58424691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58418455 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 344 (N344D)
Ref Sequence ENSEMBL: ENSMUSP00000101108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020077] [ENSMUST00000020078] [ENSMUST00000105468]
Predicted Effect probably benign
Transcript: ENSMUST00000020077
AA Change: N344D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020077
Gene: ENSMUSG00000019920
AA Change: N344D

DomainStartEndE-ValueType
LIM 71 124 3.78e-15 SMART
LIM 132 183 5.35e-15 SMART
LIM 196 246 1.01e-10 SMART
LIM 254 305 2.84e-19 SMART
LIM 313 365 3.84e-16 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000020078
AA Change: N294D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020078
Gene: ENSMUSG00000019920
AA Change: N294D

DomainStartEndE-ValueType
LIM 21 74 3.78e-15 SMART
LIM 82 133 5.35e-15 SMART
LIM 146 196 1.01e-10 SMART
LIM 204 255 2.84e-19 SMART
LIM 263 315 5.51e-17 SMART
low complexity region 317 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105468
AA Change: N344D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101108
Gene: ENSMUSG00000019920
AA Change: N344D

DomainStartEndE-ValueType
LIM 71 124 3.78e-15 SMART
LIM 132 183 5.35e-15 SMART
LIM 196 246 1.01e-10 SMART
LIM 254 305 2.84e-19 SMART
LIM 313 365 5.51e-17 SMART
low complexity region 367 384 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148799
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice die shortly after implantation and have a disorganized egg cylinder by E5.5, which is degenerated by E6.5. E5.5 null embryos exhibit decreased cell proliferation and excessive cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Lims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0027:Lims1 UTSW 10 58418455 missense probably benign 0.00
R4271:Lims1 UTSW 10 58410204 critical splice donor site probably null
R4528:Lims1 UTSW 10 58410060 missense probably damaging 1.00
R4546:Lims1 UTSW 10 58418790 intron probably benign
R4992:Lims1 UTSW 10 58410241 intron probably benign
R5380:Lims1 UTSW 10 58416670 missense probably damaging 0.99
R6207:Lims1 UTSW 10 58394564 missense possibly damaging 0.76
R6543:Lims1 UTSW 10 58412451 nonsense probably null
R6684:Lims1 UTSW 10 58399013 splice site probably null
R6762:Lims1 UTSW 10 58412545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGTTAGAAGCATACGAGGAGCATC -3'
(R):5'- TCCCTTTGAGTGGAACAAAGAAAGGAC -3'

Sequencing Primer
(F):5'- tcaaggaggataaagcaggaag -3'
(R):5'- CAGAACAGGAACAATTAAAGAAGAAC -3'
Posted On2013-09-03