Incidental Mutation 'T0722:Cdk5r1'
ID67343
Institutional Source Beutler Lab
Gene Symbol Cdk5r1
Ensembl Gene ENSMUSG00000048895
Gene Namecyclin-dependent kinase 5, regulatory subunit 1 (p35)
SynonymsD11Bwg0379e, p35, p25
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #T0722 (G3) of strain 711
Quality Score194
Status Validated
Chromosome11
Chromosomal Location80477023-80481184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80477881 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 125 (V125F)
Ref Sequence ENSEMBL: ENSMUSP00000099514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000041065] [ENSMUST00000053413] [ENSMUST00000147694]
Predicted Effect probably benign
Transcript: ENSMUST00000017572
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041065
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053413
AA Change: V125F

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895
AA Change: V125F

DomainStartEndE-ValueType
Pfam:CDK5_activator 69 294 1.6e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147694
AA Change: V125F

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120964
Gene: ENSMUSG00000048895
AA Change: V125F

DomainStartEndE-ValueType
Pfam:CDK5_activator 1 138 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173797
SMART Domains Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
Blast:PAM 2 58 9e-33 BLAST
PINT 59 142 4.34e-23 SMART
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of the gene results in structural abnormalities of the brain such as a small corpus callosum and delaminated cerebral cortex. Mice show hyperactivity and decreased locomotion in response to stimulants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Cdk5r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02450:Cdk5r1 APN 11 80477840 missense probably benign 0.09
IGL02754:Cdk5r1 APN 11 80477743 missense probably benign 0.00
R0230:Cdk5r1 UTSW 11 80477750 missense probably damaging 1.00
R4166:Cdk5r1 UTSW 11 80478209 missense probably damaging 1.00
R5537:Cdk5r1 UTSW 11 80477999 missense probably damaging 1.00
R5926:Cdk5r1 UTSW 11 80478302 unclassified probably null
R6350:Cdk5r1 UTSW 11 80478242 missense probably damaging 1.00
R6841:Cdk5r1 UTSW 11 80478195 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGGCCACACTGTTTGAGGATG -3'
(R):5'- GTCCCAAAAGGCTTCCTTACAGCTC -3'

Sequencing Primer
(F):5'- CTGCCTTGGAAGAGGATCG -3'
(R):5'- CTCATTGCCCATGTAGGAATAGG -3'
Posted On2013-09-03