Incidental Mutation 'T0722:Bicd2'
ID67349
Institutional Source Beutler Lab
Gene Symbol Bicd2
Ensembl Gene ENSMUSG00000037933
Gene NameBICD cargo adaptor 2
Synonyms0610027D24Rik, 1110005D12Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49341585-49387026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49379651 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 571 (P571Q)
Ref Sequence ENSEMBL: ENSMUSP00000105712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085] [ENSMUST00000220723]
Predicted Effect probably benign
Transcript: ENSMUST00000048544
AA Change: P571Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933
AA Change: P571Q

DomainStartEndE-ValueType
internal_repeat_1 22 50 2.25e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110084
AA Change: P497Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933
AA Change: P497Q

DomainStartEndE-ValueType
Pfam:BicD 9 723 N/A PFAM
low complexity region 733 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110085
AA Change: P571Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933
AA Change: P571Q

DomainStartEndE-ValueType
internal_repeat_1 22 50 1.16e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220723
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show postnatal and premature death associated with progressive hydrocephalus, enlarged lateral ventricles, aqueductal stenosis, abnormal gait, disrupted laminar organization of the cerebral cortex and cerebellum, and impaired cerebellar granule cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Bicd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Bicd2 APN 13 49378316 missense probably damaging 1.00
IGL02029:Bicd2 APN 13 49369499 missense probably damaging 1.00
IGL02052:Bicd2 APN 13 49379189 missense possibly damaging 0.91
IGL02955:Bicd2 APN 13 49378215 missense probably benign
IGL03033:Bicd2 APN 13 49379920 missense probably benign 0.09
IGL03395:Bicd2 APN 13 49375258 missense probably damaging 1.00
IGL02802:Bicd2 UTSW 13 49378328 missense probably damaging 1.00
P0027:Bicd2 UTSW 13 49379651 missense probably benign 0.05
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0393:Bicd2 UTSW 13 49379870 missense probably damaging 1.00
R0718:Bicd2 UTSW 13 49377875 splice site probably null
R0730:Bicd2 UTSW 13 49378241 missense possibly damaging 0.77
R1716:Bicd2 UTSW 13 49378310 missense probably benign
R2004:Bicd2 UTSW 13 49379405 missense possibly damaging 0.50
R2041:Bicd2 UTSW 13 49341776 missense probably benign 0.02
R2151:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2152:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2444:Bicd2 UTSW 13 49379024 missense probably benign 0.00
R4085:Bicd2 UTSW 13 49384962 splice site probably null
R4477:Bicd2 UTSW 13 49377972 missense probably damaging 1.00
R4824:Bicd2 UTSW 13 49379012 missense probably damaging 1.00
R4979:Bicd2 UTSW 13 49379464 missense possibly damaging 0.89
R6348:Bicd2 UTSW 13 49379846 missense probably damaging 1.00
X0003:Bicd2 UTSW 13 49379651 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCCTCTCTGAGCAGCATGAGAAG -3'
(R):5'- GTAGATGTTCATAGGTTCCCGGCG -3'

Sequencing Primer
(F):5'- CACTGAGAAGATCTCTCTGCTGG -3'
(R):5'- CGGGGGTCACTCAGAGG -3'
Posted On2013-09-03