Incidental Mutation 'T0722:Sim2'
ID67353
Institutional Source Beutler Lab
Gene Symbol Sim2
Ensembl Gene ENSMUSG00000062713
Gene Namesingle-minded family bHLH transcription factor 2
SynonymsbHLHe15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94084931-94127032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94109422 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 228 (H228N)
Ref Sequence ENSEMBL: ENSMUSP00000072043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072182] [ENSMUST00000231688]
Predicted Effect probably benign
Transcript: ENSMUST00000072182
AA Change: H228N

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072043
Gene: ENSMUSG00000062713
AA Change: H228N

DomainStartEndE-ValueType
HLH 6 58 6.99e-5 SMART
PAS 79 145 7.8e-13 SMART
PAS 220 286 1.31e-5 SMART
PAC 292 335 2.44e-5 SMART
Pfam:SIM_C 358 650 4.5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231688
AA Change: H228N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1352 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a homolog of the Drosophila single-minded (sim) gene, which encodes a transcription factor that is a master regulator of neurogenesis. The encoded protein is ubiquitinated by RING-IBR-RING-type E3 ubiquitin ligases, including the parkin RBR E3 ubiquitin protein ligase. This gene maps within the so-called Down syndrome chromosomal region, and is thus thought to contribute to some specific Down syndrome phenotypes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, cleft palate, malformed pterygoid processes, and aerophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Sim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sim2 APN 16 94114944 nonsense probably null
IGL01329:Sim2 APN 16 94106260 missense possibly damaging 0.64
IGL01965:Sim2 APN 16 94121178 missense probably benign 0.20
IGL01979:Sim2 APN 16 94123482 missense possibly damaging 0.81
IGL02821:Sim2 APN 16 94097188 missense probably damaging 1.00
IGL03027:Sim2 APN 16 94109492 splice site probably benign
P0027:Sim2 UTSW 16 94109422 missense probably benign 0.02
R1836:Sim2 UTSW 16 94123577 critical splice donor site probably null
R2034:Sim2 UTSW 16 94085942 missense probably damaging 0.96
R4085:Sim2 UTSW 16 94109354 missense possibly damaging 0.48
R4475:Sim2 UTSW 16 94125791 missense probably benign
R4476:Sim2 UTSW 16 94125791 missense probably benign
R4647:Sim2 UTSW 16 94123526 missense possibly damaging 0.71
R4919:Sim2 UTSW 16 94109335 missense probably benign 0.01
R4966:Sim2 UTSW 16 94123421 missense probably benign 0.03
R5320:Sim2 UTSW 16 94104739 missense probably benign 0.01
R5555:Sim2 UTSW 16 94109456 missense probably damaging 1.00
R5591:Sim2 UTSW 16 94097189 missense probably damaging 1.00
R5870:Sim2 UTSW 16 94123334 missense probably damaging 0.99
R6020:Sim2 UTSW 16 94097251 missense probably damaging 1.00
R6302:Sim2 UTSW 16 94097230 missense probably damaging 1.00
R6885:Sim2 UTSW 16 94125536 missense probably benign 0.00
X0063:Sim2 UTSW 16 94122698 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAACTTGGGTGAAGGATGGCCTAC -3'
(R):5'- CGTATGGTCAGTGTGCATCACAAGC -3'

Sequencing Primer
(F):5'- GGATGGCCTACCACTTCAAAAAC -3'
(R):5'- GTGTGCATCACAAGCTTACAATC -3'
Nature of Mutation

    ACGGAGATCAAGCTCCACAGCAACATGTTCATG

223 -T--E--I--K--L--H--S--N--M--F--M-

 

Genotyping

NOTE: These primers have not been validated.

 

T0722:Sim2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

T07220040_Sim2_PCR_F: 5’- GAACTTGGGTGAAGGATGGCCTAC-3’

T07220040_Sim2_PCR_R: 5’- CGTATGGTCAGTGTGCATCACAAGC-3’

 

Sequencing Primers

T07220040_Sim2_SEQ_F: 5’- GGATGGCCTACCACTTCAAAAAC-3’
 

T07220040_Sim2_SEQ_R: 5’- GTGTGCATCACAAGCTTACAATC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 502 nucleotides is amplified (Chr.16: 94109175-94109676, GRCm38; NCBI RefSeq: NC_000082):

 

gaacttgggt gaaggatggc ctaccacttc aaaaacaaat gaacaaacaa agccaaaaaa       

agctaaggca gagcggtggt gccccctgag cctgtgtctt ccttcccagg tcattcactg      

cagcggctac ctaaagatca gacagtacat gctggacatg tccctgtacg actcctgtta      

ccagatcgtg gggctggtgg ccgtgggcca gtcgctaccg cccagcgcca tcacggagat      

caagctccac agcaacatgt tcatgttcag ggccagcctt gacctgaagc tcatattcct      

ggactccagg tgagtctgcc tggccccagc tgtcaccatt gctgtgactg cccagaaagc      

cccggtgctg gaactggtcg cagatgagca aggaagttag tcatgaggta aagaattcag      

gacagactta agatgcagga acttgtttta atgaattgcc taatgtttgg attgtaagct      

tgtgatgcac actgaccata cg

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated C is shown in red text (C>A).

Posted On2013-09-03