Incidental Mutation 'R0729:Capzb'
ID67370
Institutional Source Beutler Lab
Gene Symbol Capzb
Ensembl Gene ENSMUSG00000028745
Gene Namecapping protein (actin filament) muscle Z-line, beta
Synonyms1700120C01Rik, CPB2, Cappb1, CPbeta1, CPbeta2, CPB1
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0729 (G1)
Quality Score182
Status Validated
Chromosome4
Chromosomal Location139192899-139291818 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 139288977 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030518] [ENSMUST00000042675] [ENSMUST00000102507] [ENSMUST00000102508] [ENSMUST00000138045]
Predicted Effect probably benign
Transcript: ENSMUST00000030518
SMART Domains Protein: ENSMUSP00000030518
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 35 269 6.2e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042675
SMART Domains Protein: ENSMUSP00000038011
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 228 4.7e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102507
SMART Domains Protein: ENSMUSP00000099565
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 6 240 4.6e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102508
SMART Domains Protein: ENSMUSP00000099566
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 240 6.8e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132385
Predicted Effect probably benign
Transcript: ENSMUST00000138045
SMART Domains Protein: ENSMUSP00000122077
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 204 9.8e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150077
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in the ear exhibit increased ABR threshold, absent DPOE, reduced vestibular function, head shaking and abnormal stereocilia length and width in the cochlea and utricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Blvrb A G 7: 27,448,130 K5E possibly damaging Het
Cacna2d2 A G 9: 107,517,257 N573D probably benign Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Ddx31 T C 2: 28,874,174 I464T probably damaging Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Lrrc74a C T 12: 86,745,579 Q225* probably null Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Map3k10 G A 7: 27,661,567 P507L probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pcdh12 A G 18: 38,282,464 I536T probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Smg1 C A 7: 118,146,289 probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Capzb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Capzb APN 4 139288947 missense probably benign 0.00
IGL00885:Capzb APN 4 139287050 missense probably benign 0.00
R0612:Capzb UTSW 4 139291029 missense probably benign
R1547:Capzb UTSW 4 139262098 unclassified probably null
R1731:Capzb UTSW 4 139280030 missense probably damaging 1.00
R1748:Capzb UTSW 4 139257368 missense probably damaging 1.00
R2234:Capzb UTSW 4 139262023 missense possibly damaging 0.80
R2424:Capzb UTSW 4 139194130 start codon destroyed probably null 0.01
R4799:Capzb UTSW 4 139192999 utr 5 prime probably benign
R5076:Capzb UTSW 4 139287814 missense possibly damaging 0.85
R5596:Capzb UTSW 4 139279427 intron probably benign
R6200:Capzb UTSW 4 139280013 missense probably benign 0.33
X0012:Capzb UTSW 4 139257291 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACGAGGAACATCTGAGCCTGTGTG -3'
(R):5'- AACCTGGCTTTTGCCCAGAGTG -3'

Sequencing Primer
(F):5'- TCGGGTGTGAACCCCTAAAG -3'
(R):5'- TTTGCCCAGAGTGCAGAG -3'
Posted On2013-09-03