Incidental Mutation 'R0729:Smg1'
ID67388
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene NameSMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0729 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118131308-118243670 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to A at 118146289 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: A2967S
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: A2967S

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178025
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Blvrb A G 7: 27,448,130 K5E possibly damaging Het
Cacna2d2 A G 9: 107,517,257 N573D probably benign Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Capzb T C 4: 139,288,977 probably benign Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Ddx31 T C 2: 28,874,174 I464T probably damaging Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Lrrc74a C T 12: 86,745,579 Q225* probably null Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Map3k10 G A 7: 27,661,567 P507L probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pcdh12 A G 18: 38,282,464 I536T probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCAATCTTCCGCCAAGCAACAG -3'
(R):5'- TGTAGCACCATTGCACCTGACAG -3'

Sequencing Primer
(F):5'- GGAATGCTCACTTTCCTCTGTTC -3'
(R):5'- CAAAACTGAGCTGGACTCATTG -3'
Posted On2013-09-03