Incidental Mutation 'R0729:Cacna2d2'
ID67400
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R0729 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107517257 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 573 (N573D)
Ref Sequence ENSEMBL: ENSMUSP00000125943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably benign
Transcript: ENSMUST00000010210
AA Change: N573D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: N573D

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085092
AA Change: N573D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: N573D

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164988
AA Change: N573D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: N573D

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166799
AA Change: N573D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: N573D

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168532
AA Change: N573D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: N573D

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169354
Predicted Effect probably benign
Transcript: ENSMUST00000170737
AA Change: N573D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: N573D

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194842
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Blvrb A G 7: 27,448,130 K5E possibly damaging Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Capzb T C 4: 139,288,977 probably benign Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Ddx31 T C 2: 28,874,174 I464T probably damaging Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Lrrc74a C T 12: 86,745,579 Q225* probably null Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Map3k10 G A 7: 27,661,567 P507L probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pcdh12 A G 18: 38,282,464 I536T probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Smg1 C A 7: 118,146,289 probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGGAAATGGAGAATGCCCACCTAC -3'
(R):5'- TTGTCGCCGTCAATCATGCTGC -3'

Sequencing Primer
(F):5'- TAGTCAACCTTGGCGTGGAC -3'
(R):5'- GCGCCAGCTATTTTCTTGTG -3'
Posted On2013-09-03