Incidental Mutation 'R0729:Lrrc74a'
Institutional Source Beutler Lab
Gene Symbol Lrrc74a
Ensembl Gene ENSMUSG00000059114
Gene Nameleucine rich repeat containing 74A
SynonymsLrrc74, Gm6772
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0729 (G1)
Quality Score225
Status Validated
Chromosomal Location86734369-86763797 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 86745579 bp
Amino Acid Change Glutamine to Stop codon at position 225 (Q225*)
Ref Sequence ENSEMBL: ENSMUSP00000152661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095527] [ENSMUST00000222180] [ENSMUST00000223308]
Predicted Effect probably null
Transcript: ENSMUST00000095527
AA Change: Q225*
SMART Domains Protein: ENSMUSP00000093183
Gene: ENSMUSG00000059114
AA Change: Q225*

Blast:LRR 87 116 9e-7 BLAST
LRR 117 144 4.17e-3 SMART
LRR 145 172 3.16e-3 SMART
LRR 174 201 1.92e-2 SMART
LRR 202 229 3.07e-1 SMART
LRR 230 257 1.03e-2 SMART
LRR 258 285 1.64e-1 SMART
LRR 286 313 2.03e0 SMART
LRR 314 341 1.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222180
Predicted Effect probably benign
Transcript: ENSMUST00000223197
Predicted Effect probably null
Transcript: ENSMUST00000223308
AA Change: Q225*
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Blvrb A G 7: 27,448,130 K5E possibly damaging Het
Cacna2d2 A G 9: 107,517,257 N573D probably benign Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Capzb T C 4: 139,288,977 probably benign Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Ddx31 T C 2: 28,874,174 I464T probably damaging Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Map3k10 G A 7: 27,661,567 P507L probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pcdh12 A G 18: 38,282,464 I536T probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Smg1 C A 7: 118,146,289 probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Lrrc74a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lrrc74a APN 12 86754430 missense probably damaging 1.00
IGL01380:Lrrc74a APN 12 86761722 missense possibly damaging 0.62
IGL01715:Lrrc74a APN 12 86754415 missense probably benign 0.05
IGL01832:Lrrc74a APN 12 86761714 missense probably benign 0.00
IGL01953:Lrrc74a APN 12 86741720 missense probably damaging 1.00
IGL02218:Lrrc74a APN 12 86749048 missense probably benign 0.15
IGL02637:Lrrc74a APN 12 86741747 nonsense probably null
IGL03397:Lrrc74a APN 12 86758538 missense probably benign 0.39
R0201:Lrrc74a UTSW 12 86761773 splice site probably benign
R0360:Lrrc74a UTSW 12 86737795 missense probably damaging 1.00
R0403:Lrrc74a UTSW 12 86740979 missense probably damaging 1.00
R1675:Lrrc74a UTSW 12 86741026 missense probably damaging 1.00
R1774:Lrrc74a UTSW 12 86749053 missense probably damaging 1.00
R1818:Lrrc74a UTSW 12 86737710 missense probably damaging 1.00
R4688:Lrrc74a UTSW 12 86737698 nonsense probably null
R6023:Lrrc74a UTSW 12 86758606 missense probably damaging 1.00
R6190:Lrrc74a UTSW 12 86736489 missense probably benign 0.01
R6226:Lrrc74a UTSW 12 86748457 missense possibly damaging 0.87
R6247:Lrrc74a UTSW 12 86758556 missense probably damaging 1.00
R7275:Lrrc74a UTSW 12 86740979 missense probably damaging 1.00
X0024:Lrrc74a UTSW 12 86749045 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgaaggcagagggtagagag -3'
Posted On2013-09-03