Incidental Mutation 'R0730:Pdia3'
ID67440
Institutional Source Beutler Lab
Gene Symbol Pdia3
Ensembl Gene ENSMUSG00000027248
Gene Nameprotein disulfide isomerase associated 3
SynonymsERp61, Plca, PDI, Grp58, Erp, PDI-Q2, ERp57, ERp60
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121413775-121438687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121432377 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 275 (G275S)
Ref Sequence ENSEMBL: ENSMUSP00000028683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028683] [ENSMUST00000135079]
Predicted Effect probably damaging
Transcript: ENSMUST00000028683
AA Change: G275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028683
Gene: ENSMUSG00000027248
AA Change: G275S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Thioredoxin 26 131 5.2e-36 PFAM
Pfam:Thioredoxin_6 160 355 2e-29 PFAM
Pfam:Thioredoxin 377 483 9.5e-33 PFAM
low complexity region 487 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130450
Predicted Effect probably benign
Transcript: ENSMUST00000135079
SMART Domains Protein: ENSMUSP00000119337
Gene: ENSMUSG00000027248

DomainStartEndE-ValueType
Pfam:Thioredoxin 3 105 5.1e-35 PFAM
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die by E13.5 with minor changes in ER calcium capacity and unfolded protein response in mouse embryonic fibroblasts. Mice homozygous for a gene trap allele die prior to birth while heterozygous mice exhibit abnormalbone volume bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 probably benign Het
Gnat1 G A 9: 107,679,463 T29I probably damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1808E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Pdia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pdia3 APN 2 121414178 missense probably damaging 1.00
IGL00777:Pdia3 APN 2 121429556 missense probably damaging 1.00
IGL02020:Pdia3 APN 2 121436419 splice site probably null
IGL02437:Pdia3 APN 2 121433648 missense probably damaging 1.00
IGL02988:Pdia3 UTSW 2 121429556 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0606:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0612:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0658:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0724:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0880:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0882:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1157:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1160:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1238:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1619:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1853:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R1854:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R2014:Pdia3 UTSW 2 121434820 missense probably damaging 1.00
R2103:Pdia3 UTSW 2 121433993 missense probably damaging 1.00
R4160:Pdia3 UTSW 2 121414115 missense probably damaging 1.00
R4628:Pdia3 UTSW 2 121414139 missense possibly damaging 0.91
R5032:Pdia3 UTSW 2 121414139 missense probably benign 0.28
R5279:Pdia3 UTSW 2 121414003 unclassified probably benign
R5598:Pdia3 UTSW 2 121414130 missense possibly damaging 0.53
R5815:Pdia3 UTSW 2 121436411 nonsense probably null
X0012:Pdia3 UTSW 2 121435945 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTGTGGACCCATTACCTCTTACAGTG -3'
(R):5'- GCAGTTTCTGGAGCTATGTGTTCCC -3'

Sequencing Primer
(F):5'- GCATTGTGTTGATAATGACTTCCTC -3'
(R):5'- gtccagattagccacaaattcag -3'
Posted On2013-09-03