Incidental Mutation 'R0730:Celsr2'
ID67442
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
MMRRC Submission 038911-MU
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108398606 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 2061 (N2061Y)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
Predicted Effect probably damaging
Transcript: ENSMUST00000090558
AA Change: N2061Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: N2061Y

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130941
Predicted Effect unknown
Transcript: ENSMUST00000147251
AA Change: N49Y
SMART Domains Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: N49Y

DomainStartEndE-ValueType
Pfam:GAIN 35 278 5.1e-63 PFAM
GPS 304 357 1.86e-25 SMART
Pfam:7tm_2 362 594 2e-49 PFAM
low complexity region 704 722 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 863 870 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147565
SMART Domains Protein: ENSMUSP00000122516
Gene: ENSMUSG00000068740

DomainStartEndE-ValueType
EGF 13 46 8e-5 SMART
LamG 72 206 1.56e-24 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 probably benign Het
Gnat1 G A 9: 107,679,463 T29I probably damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1808E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
goldeneye UTSW 3 108394919 missense
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCCAGGAACAGGCTGTCTCAC -3'
(R):5'- AGGGCTTCGTAAGTTGATCCCTCG -3'

Sequencing Primer
(F):5'- GGCTGTCTCACTGGCCC -3'
(R):5'- ACACCCTTGTCTTTGGAAGTAG -3'
Posted On2013-09-03