Incidental Mutation 'R0730:Cntn4'
ID67456
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106550486 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 443 (K443T)
Ref Sequence ENSEMBL: ENSMUSP00000078385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113258] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably damaging
Transcript: ENSMUST00000079416
AA Change: K443T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293
AA Change: K443T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089208
AA Change: K443T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293
AA Change: K443T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113258
AA Change: K443T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108883
Gene: ENSMUSG00000064293
AA Change: K443T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113260
AA Change: K443T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293
AA Change: K443T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113261
AA Change: K443T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293
AA Change: K443T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113264
AA Change: K443T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293
AA Change: K443T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132395
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 probably benign Het
Gnat1 G A 9: 107,679,463 T29I possibly damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1808E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATCAGGAAACTTGCCAAATGCAGC -3'
(R):5'- ACATGGAGGTCAGAGTTACCATTGTCT -3'

Sequencing Primer
(F):5'- ACAGGGGGCTAAGAATGTTTCTATC -3'
(R):5'- ATACCTTCTGGATTTGATTATTTGCT -3'
Posted On2013-09-03