Incidental Mutation 'R0730:Mgst1'
ID67462
Institutional Source Beutler Lab
Gene Symbol Mgst1
Ensembl Gene ENSMUSG00000008540
Gene Namemicrosomal glutathione S-transferase 1
Synonyms
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location138140316-138156755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138147669 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 34 (T34S)
Ref Sequence ENSEMBL: ENSMUSP00000114222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008684] [ENSMUST00000118091] [ENSMUST00000120230] [ENSMUST00000120302] [ENSMUST00000120939] [ENSMUST00000125810] [ENSMUST00000140932] [ENSMUST00000204628]
Predicted Effect probably benign
Transcript: ENSMUST00000008684
SMART Domains Protein: ENSMUSP00000008684
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118091
AA Change: T68S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112923
Gene: ENSMUSG00000008540
AA Change: T68S

DomainStartEndE-ValueType
Pfam:MAPEG 90 224 1.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120230
SMART Domains Protein: ENSMUSP00000113859
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120302
SMART Domains Protein: ENSMUSP00000113257
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120939
SMART Domains Protein: ENSMUSP00000112646
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
PDB:2H8A|A 2 74 1e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000125810
AA Change: T34S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114222
Gene: ENSMUSG00000008540
AA Change: T34S

DomainStartEndE-ValueType
PDB:2H8A|A 42 92 6e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140932
SMART Domains Protein: ENSMUSP00000145306
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 1 46 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204628
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 probably benign Het
Gnat1 G A 9: 107,679,463 T29I probably damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1808E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Mgst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Mgst1 APN 6 138147768 missense probably damaging 0.99
R0319:Mgst1 UTSW 6 138156157 missense possibly damaging 0.81
R0613:Mgst1 UTSW 6 138156245 missense probably damaging 1.00
R0634:Mgst1 UTSW 6 138156331 missense probably damaging 1.00
R0862:Mgst1 UTSW 6 138147751 missense probably damaging 1.00
R4447:Mgst1 UTSW 6 138141664 intron probably benign
R4569:Mgst1 UTSW 6 138156215 missense probably damaging 0.99
R4644:Mgst1 UTSW 6 138156370 missense probably damaging 1.00
R4701:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R4930:Mgst1 UTSW 6 138153509 missense probably benign 0.00
R5688:Mgst1 UTSW 6 138141800 intron probably benign
R6307:Mgst1 UTSW 6 138150829 missense probably benign 0.44
R6468:Mgst1 UTSW 6 138141587 unclassified probably null
R6697:Mgst1 UTSW 6 138147753 missense probably damaging 1.00
R6741:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R6755:Mgst1 UTSW 6 138147772 missense probably damaging 0.99
R6791:Mgst1 UTSW 6 138141807 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGCGAGGATGCAATCAGTTCCC -3'
(R):5'- ACTCTGCTCACAGCATAGCACG -3'

Sequencing Primer
(F):5'- GGATGCAATCAGTTCCCTTGTAAAC -3'
(R):5'- GAAATCGACAAGGCTGTTTTCAG -3'
Posted On2013-09-03