Incidental Mutation 'R0730:Fgfr1'
ID67466
Institutional Source Beutler Lab
Gene Symbol Fgfr1
Ensembl Gene ENSMUSG00000031565
Gene Namefibroblast growth factor receptor 1
SynonymsEask, Hspy, Fgfr-1, Flt-2
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25513654-25575718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25555744 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 123 (D123N)
Ref Sequence ENSEMBL: ENSMUSP00000136640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084027] [ENSMUST00000117179] [ENSMUST00000119398] [ENSMUST00000124228] [ENSMUST00000155564] [ENSMUST00000167764] [ENSMUST00000178276] [ENSMUST00000179592] [ENSMUST00000210846]
Predicted Effect probably benign
Transcript: ENSMUST00000084027
AA Change: D110N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081041
Gene: ENSMUSG00000031565
AA Change: D110N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 169 237 4.09e-9 SMART
IGc2 268 348 1.26e-9 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
TyrKc 478 754 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117179
AA Change: D110N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113909
Gene: ENSMUSG00000031565
AA Change: D110N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 167 235 4.09e-9 SMART
IGc2 266 346 1.26e-9 SMART
transmembrane domain 373 395 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
TyrKc 476 752 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119398
SMART Domains Protein: ENSMUSP00000113855
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 80 148 4.09e-9 SMART
IGc2 179 259 1.26e-9 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124228
SMART Domains Protein: ENSMUSP00000116564
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 104 5.75e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126122
Predicted Effect unknown
Transcript: ENSMUST00000138104
AA Change: D43N
Predicted Effect probably benign
Transcript: ENSMUST00000138455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148322
Predicted Effect probably benign
Transcript: ENSMUST00000155564
SMART Domains Protein: ENSMUSP00000117884
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:2CKN|A 25 51 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167764
SMART Domains Protein: ENSMUSP00000131343
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178276
SMART Domains Protein: ENSMUSP00000137515
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179592
AA Change: D123N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136640
Gene: ENSMUSG00000031565
AA Change: D123N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 121 2.94e-10 SMART
low complexity region 137 151 N/A INTRINSIC
IGc2 180 248 4.09e-9 SMART
IGc2 279 359 1.26e-9 SMART
transmembrane domain 386 408 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
TyrKc 489 765 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210778
Predicted Effect probably benign
Transcript: ENSMUST00000210846
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die around gastrulation and show defective patterning of axial structures. Hypomorphic and selectively ablated mutations exhibit a wide range of abnormalities affecting diverse structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1605H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
G530012D18Rik A C 1: 85,577,036 H54P probably benign Het
Gnat1 G A 9: 107,679,463 T29I possibly damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 S432P probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1855E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 E41G probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Fgfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fgfr1 APN 8 25562223 nonsense probably null
IGL01537:Fgfr1 APN 8 25555579 missense probably damaging 1.00
IGL01643:Fgfr1 APN 8 25566735 missense probably benign 0.01
IGL01875:Fgfr1 APN 8 25573553 missense possibly damaging 0.81
IGL02002:Fgfr1 APN 8 25555711 missense probably damaging 1.00
IGL02698:Fgfr1 APN 8 25573608 nonsense probably null
IGL02822:Fgfr1 APN 8 25557802 missense probably benign 0.13
IGL03292:Fgfr1 APN 8 25557755 missense possibly damaging 0.50
R0003:Fgfr1 UTSW 8 25568198 missense possibly damaging 0.80
R0723:Fgfr1 UTSW 8 25557768 missense probably damaging 0.99
R1144:Fgfr1 UTSW 8 25558143 missense probably damaging 1.00
R1455:Fgfr1 UTSW 8 25562276 missense possibly damaging 0.81
R1591:Fgfr1 UTSW 8 25572720 missense probably damaging 1.00
R1754:Fgfr1 UTSW 8 25570210 missense probably damaging 1.00
R2045:Fgfr1 UTSW 8 25558215 missense probably benign 0.04
R2139:Fgfr1 UTSW 8 25570866 missense probably damaging 1.00
R2314:Fgfr1 UTSW 8 25570893 missense probably damaging 1.00
R2517:Fgfr1 UTSW 8 25563446 missense probably damaging 1.00
R2982:Fgfr1 UTSW 8 25558211 missense probably benign 0.04
R3796:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3797:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3799:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R4323:Fgfr1 UTSW 8 25573899 missense probably benign 0.37
R4594:Fgfr1 UTSW 8 25573836 missense probably damaging 0.99
R4614:Fgfr1 UTSW 8 25557797 missense probably benign 0.25
R4696:Fgfr1 UTSW 8 25563488 missense probably damaging 0.99
R4916:Fgfr1 UTSW 8 25563526 critical splice donor site probably null
R4966:Fgfr1 UTSW 8 25572445 nonsense probably null
R5094:Fgfr1 UTSW 8 25570165 missense probably damaging 1.00
R5730:Fgfr1 UTSW 8 25573811 missense probably damaging 1.00
R5911:Fgfr1 UTSW 8 25519309 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGATGATGTGCAGAGCATCAAC -3'
(R):5'- GGACTGCTGTGCTGGAGAAATGAC -3'

Sequencing Primer
(F):5'- AGAGCATCAACTGGCTGC -3'
(R):5'- CATAATCACCTCTGAGGTAGGTC -3'
Posted OnSep 03, 2013