Incidental Mutation 'R0730:Bsn'
ID67477
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 038911-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108106812 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 3348 (M3348L)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: M3348L
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: M3348L

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198370
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures.
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I671F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T332S probably damaging Het
App A G 16: 85,079,952 F184L unknown Het
Arhgef38 T A 3: 133,137,471 Y446F unknown Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 noncoding transcript Het
Bdp1 G A 13: 100,058,951 noncoding transcript Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Cacna1c C T 6: 118,612,625 R1577H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 noncoding transcript Het
Dgkh T C 14: 78,584,479 I998V probably benign Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 noncoding transcript Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 H54P unknown Het
Gnat1 G A 9: 107,679,463 T29I unknown Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 noncoding transcript Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 S432P unknown Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1855E probably damaging Het
Ramp3 T C 11: 6,676,476 noncoding transcript Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 E41G unknown Het
Ufd1l A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 noncoding transcript Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 missense unknown
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 missense unknown
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 missense unknown
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 missense unknown
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 missense unknown
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 missense unknown
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 missense unknown
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 missense unknown
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 missense unknown
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 missense unknown
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 missense unknown
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACCGCTGCTGTTCGTACAC -3'
(R):5'- TCGACGACATCAGCGAACTGAC -3'

Sequencing Primer
(F):5'- CCATAGGTGATTTCATCCTGGAAC -3'
(R):5'- TTGAGGGACCCACTCTGC -3'
Posted OnSep 03, 2013