Incidental Mutation 'R0730:Bicd2'
ID67498
Institutional Source Beutler Lab
Gene Symbol Bicd2
Ensembl Gene ENSMUSG00000037933
Gene NameBICD cargo adaptor 2
Synonyms0610027D24Rik, 1110005D12Rik
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49341585-49387026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49378241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 246 (S246T)
Ref Sequence ENSEMBL: ENSMUSP00000039394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085] [ENSMUST00000220723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048544
AA Change: S320T

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933
AA Change: S320T

DomainStartEndE-ValueType
internal_repeat_1 22 50 2.25e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110084
AA Change: S246T

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933
AA Change: S246T

DomainStartEndE-ValueType
Pfam:BicD 9 723 N/A PFAM
low complexity region 733 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110085
AA Change: S320T

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933
AA Change: S320T

DomainStartEndE-ValueType
internal_repeat_1 22 50 1.16e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220723
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show postnatal and premature death associated with progressive hydrocephalus, enlarged lateral ventricles, aqueductal stenosis, abnormal gait, disrupted laminar organization of the cerebral cortex and cerebellum, and impaired cerebellar granule cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1605H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 H54P probably benign Het
Gnat1 G A 9: 107,679,463 T29I possibly damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 S432P probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1855E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 E41G probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Bicd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Bicd2 APN 13 49378316 missense probably damaging 1.00
IGL02029:Bicd2 APN 13 49369499 missense probably damaging 1.00
IGL02052:Bicd2 APN 13 49379189 missense possibly damaging 0.91
IGL02955:Bicd2 APN 13 49378215 missense probably benign
IGL03033:Bicd2 APN 13 49379920 missense probably benign 0.09
IGL03395:Bicd2 APN 13 49375258 missense probably damaging 1.00
IGL02802:Bicd2 UTSW 13 49378328 missense probably damaging 1.00
P0027:Bicd2 UTSW 13 49379651 missense probably benign 0.05
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0393:Bicd2 UTSW 13 49379870 missense probably damaging 1.00
R0718:Bicd2 UTSW 13 49377875 splice site probably null
R1716:Bicd2 UTSW 13 49378310 missense probably benign
R2004:Bicd2 UTSW 13 49379405 missense possibly damaging 0.50
R2041:Bicd2 UTSW 13 49341776 missense probably benign 0.02
R2151:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2152:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2444:Bicd2 UTSW 13 49379024 missense probably benign 0.00
R4085:Bicd2 UTSW 13 49384962 splice site probably null
R4477:Bicd2 UTSW 13 49377972 missense probably damaging 1.00
R4824:Bicd2 UTSW 13 49379012 missense probably damaging 1.00
R4979:Bicd2 UTSW 13 49379464 missense possibly damaging 0.89
R6348:Bicd2 UTSW 13 49379846 missense probably damaging 1.00
T0722:Bicd2 UTSW 13 49379651 missense probably benign 0.05
X0003:Bicd2 UTSW 13 49379651 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCTCAACAGCCAGCTAGAGGATG -3'
(R):5'- GCTTACAGTGTTGCAAAAGGCACG -3'

Sequencing Primer
(F):5'- GCAAGGAGTTGTCGCACTAC -3'
(R):5'- TGCAAAAGGCACGGGGAG -3'
Posted OnSep 03, 2013