Incidental Mutation 'R0730:Bicd2'
ID67498
Institutional Source Beutler Lab
Gene Symbol Bicd2
Ensembl Gene ENSMUSG00000037933
Gene Namebicaudal D homolog 2 (Drosophila)
Synonyms0610027D24Rik, 1110005D12Rik
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49341549-49387025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49378241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 246 (S246T)
Ref Sequence ENSEMBL: ENSMUSP00000039394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048544
AA Change: S320T

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933
AA Change: S320T

DomainStartEndE-ValueType
internal_repeat_1 22 50 2.25e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110084
AA Change: S246T

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933
AA Change: S246T

DomainStartEndE-ValueType
Pfam:BicD 9 723 N/A PFAM
low complexity region 733 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110085
AA Change: S320T

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933
AA Change: S320T

DomainStartEndE-ValueType
internal_repeat_1 22 50 1.16e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I671F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T332S probably damaging Het
App A G 16: 85,079,952 F184L unknown Het
Arhgef38 T A 3: 133,137,471 Y446F unknown Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 noncoding transcript Het
Bdp1 G A 13: 100,058,951 noncoding transcript Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1577H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 noncoding transcript Het
Dgkh T C 14: 78,584,479 I998V probably benign Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 noncoding transcript Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 H54P unknown Het
Gnat1 G A 9: 107,679,463 T29I unknown Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 noncoding transcript Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 S432P unknown Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1855E probably damaging Het
Ramp3 T C 11: 6,676,476 noncoding transcript Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 E41G unknown Het
Ufd1l A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 noncoding transcript Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Bicd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Bicd2 APN 13 49378316 missense probably damaging 1.00
IGL02029:Bicd2 APN 13 49369499 missense probably damaging 1.00
IGL02052:Bicd2 APN 13 49379189 missense possibly damaging 0.91
IGL02955:Bicd2 APN 13 49378215 missense probably benign
IGL03033:Bicd2 APN 13 49379920 missense probably benign 0.09
IGL03395:Bicd2 APN 13 49375258 missense probably damaging 1.00
IGL02802:Bicd2 UTSW 13 49378328 missense probably damaging 1.00
P0027:Bicd2 UTSW 13 49379651 missense probably benign 0.05
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0393:Bicd2 UTSW 13 49379870 missense probably damaging 1.00
R0718:Bicd2 UTSW 13 49377875 splice site probably null
R1716:Bicd2 UTSW 13 49378310 missense probably benign
R2004:Bicd2 UTSW 13 49379405 missense possibly damaging 0.50
R2041:Bicd2 UTSW 13 49341776 missense probably benign 0.02
R2151:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2152:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2444:Bicd2 UTSW 13 49379024 missense probably benign 0.00
R4085:Bicd2 UTSW 13 49384962 splice site probably null
R4477:Bicd2 UTSW 13 49377972 missense probably damaging 1.00
R4824:Bicd2 UTSW 13 49379012 missense probably damaging 1.00
R4979:Bicd2 UTSW 13 49379464 missense possibly damaging 0.89
R6348:Bicd2 UTSW 13 49379846 missense probably damaging 1.00
T0722:Bicd2 UTSW 13 49379651 missense probably benign 0.05
X0003:Bicd2 UTSW 13 49379651 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCTCAACAGCCAGCTAGAGGATG -3'
(R):5'- GCTTACAGTGTTGCAAAAGGCACG -3'

Sequencing Primer
(F):5'- GCAAGGAGTTGTCGCACTAC -3'
(R):5'- TGCAAAAGGCACGGGGAG -3'
Posted OnSep 03, 2013