Incidental Mutation 'R0730:Map1b'
ID67500
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Namemicrotubule-associated protein 1B
SynonymsMtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location99421446-99516540 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 99429766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 2149 (S2149*)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
Predicted Effect probably null
Transcript: ENSMUST00000064762
AA Change: S2149*
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: S2149*

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Meta Mutation Damage Score 0.604 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1605H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 H54P probably benign Het
Gnat1 G A 9: 107,679,463 T29I possibly damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 S432P probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1855E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 E41G probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAAGGCTTGGACTTCCCATCACCC -3'
(R):5'- TGAGACCTCAGACCGATGCTACAC -3'

Sequencing Primer
(F):5'- CACCCTTTTTGACAGGTGAAG -3'
(R):5'- CACGCCAGGATGTTGATTTATG -3'
Posted OnSep 03, 2013