Incidental Mutation 'R0730:Bdp1'
ID67501
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission 038911-MU
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 100058951 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably benign
Transcript: ENSMUST00000038104
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably benign
Transcript: ENSMUST00000109379
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167815
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 probably benign Het
Gnat1 G A 9: 107,679,463 T29I possibly damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1808E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCGGATTTCTTCCCAGGCACACAG -3'
(R):5'- AAACAGACCAAGGGATGCCGCTTC -3'

Sequencing Primer
(F):5'- AGGCACACAGTGCTCTG -3'
(R):5'- ggtggaggcaaaagagtgaag -3'
Posted On2013-09-03