Incidental Mutation 'R0730:Vars'
ID67514
Institutional Source Beutler Lab
Gene Symbol Vars
Ensembl Gene ENSMUSG00000007029
Gene Namevalyl-tRNA synthetase
SynonymsBat-6, Bat6, G7a, D17H6S56E, Vars2
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35000987-35016322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35014300 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 954 (N954S)
Ref Sequence ENSEMBL: ENSMUSP00000133994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000087315] [ENSMUST00000172499] [ENSMUST00000173584]
Predicted Effect probably benign
Transcript: ENSMUST00000007245
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087315
AA Change: N954S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029
AA Change: N954S

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172499
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172999
Predicted Effect unknown
Transcript: ENSMUST00000173142
AA Change: N72S
SMART Domains Protein: ENSMUSP00000134669
Gene: ENSMUSG00000007029
AA Change: N72S

DomainStartEndE-ValueType
SCOP:d1gaxa3 32 67 3e-7 SMART
PDB:1IYW|B 36 122 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173336
Predicted Effect probably damaging
Transcript: ENSMUST00000173584
AA Change: N954S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029
AA Change: N954S

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174084
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Clk1 G A 1: 58,414,399 H343Y probably benign Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 probably benign Het
Gnat1 G A 9: 107,679,463 T29I probably damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1808E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Vars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Vars APN 17 35013873 missense probably benign 0.00
IGL02160:Vars APN 17 35001502 missense probably damaging 1.00
IGL02303:Vars APN 17 35015484
IGL03027:Vars APN 17 35013687 missense probably damaging 1.00
FR4304:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015991 small insertion probably benign
FR4589:Vars UTSW 17 35015988 small insertion probably benign
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0045:Vars UTSW 17 34998066 missense probably benign 0.13
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0266:Vars UTSW 17 35013869 missense probably benign 0.00
R0267:Vars UTSW 17 35011596 splice site probably benign
R0391:Vars UTSW 17 35011486 missense possibly damaging 0.79
R0445:Vars UTSW 17 35011809 missense probably benign 0.31
R0449:Vars UTSW 17 35012727 splice site probably null
R0557:Vars UTSW 17 35004984 missense possibly damaging 0.90
R0559:Vars UTSW 17 35014058 nonsense probably null
R0748:Vars UTSW 17 34998012 missense probably damaging 1.00
R1692:Vars UTSW 17 35013725 missense probably damaging 1.00
R1693:Vars UTSW 17 34998196 missense probably benign 0.31
R1697:Vars UTSW 17 34998222 missense probably benign 0.43
R1699:Vars UTSW 17 35014758 missense possibly damaging 0.93
R1712:Vars UTSW 17 35014752 missense probably damaging 1.00
R1989:Vars UTSW 17 35011838 missense possibly damaging 0.94
R2349:Vars UTSW 17 35015752 missense probably benign
R2365:Vars UTSW 17 35015452 missense probably benign 0.01
R3790:Vars UTSW 17 34999334 missense probably benign 0.34
R4615:Vars UTSW 17 35013881 missense probably damaging 0.97
R4844:Vars UTSW 17 35011612 missense probably damaging 1.00
R4856:Vars UTSW 17 35015726 missense probably benign 0.37
R4886:Vars UTSW 17 35015726 missense probably benign 0.37
R5570:Vars UTSW 17 35016238 missense probably benign 0.04
R5706:Vars UTSW 17 35005481 unclassified probably null
R5858:Vars UTSW 17 35005475 missense probably benign 0.30
R5907:Vars UTSW 17 35012376 missense probably damaging 1.00
R5917:Vars UTSW 17 35012515 missense probably damaging 0.99
R5944:Vars UTSW 17 35013644 missense probably damaging 1.00
R6023:Vars UTSW 17 35001609 missense probably damaging 1.00
R6073:Vars UTSW 17 35001529 missense probably benign
R6273:Vars UTSW 17 35013743 missense probably damaging 1.00
R6390:Vars UTSW 17 35015639 missense probably benign 0.00
R6658:Vars UTSW 17 35015741 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACACATCCCAAGGTATGGTCTCCC -3'
(R):5'- AGCCTTCATTGCTGAGCCTCAC -3'

Sequencing Primer
(F):5'- AAGGTATGGTCTCCCGACCTC -3'
(R):5'- CTGTCTGTCCCTGACTAAAAGGAG -3'
Posted On2013-09-03