Incidental Mutation 'R0731:Trank1'
ID67570
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 038912-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0731 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111365488 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 860 (D860G)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: D860G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: D860G

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Clk3 T C 9: 57,751,126 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kif23 T C 9: 61,925,032 R610G possibly damaging Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Map4k5 T A 12: 69,874,264 probably benign Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr484 T C 7: 108,124,734 I176M probably benign Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Ripor2 A T 13: 24,680,644 E219V probably damaging Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Wfikkn1 T A 17: 25,878,017 R444S probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp11 A G 5: 129,657,264 S378P probably damaging Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGACATCACAGTTCTGATCCAGC -3'
(R):5'- TTCTCACTGCACCGAGCAGAGAAG -3'

Sequencing Primer
(F):5'- ACAGTTCTGATCCAGCAGGTG -3'
(R):5'- GTCCAGCTTTGCTTCAAAGAG -3'
Posted On2013-09-03