Incidental Mutation 'R0732:Olfr1269'
ID67615
Institutional Source Beutler Lab
Gene Symbol Olfr1269
Ensembl Gene ENSMUSG00000084336
Gene Nameolfactory receptor 1269
SynonymsGA_x6K02T2Q125-51551618-51550689, MOR228-3
MMRRC Submission 038913-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.503) question?
Stock #R0732 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90116187-90121412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90119322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000150470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099756] [ENSMUST00000117787] [ENSMUST00000214404] [ENSMUST00000216493]
Predicted Effect probably benign
Transcript: ENSMUST00000099756
AA Change: V92A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097345
Gene: ENSMUSG00000084336
AA Change: V92A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117787
Predicted Effect probably benign
Transcript: ENSMUST00000214404
AA Change: V92A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216493
AA Change: V92A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,546,448 Y1175C probably damaging Het
Acsm3 T C 7: 119,773,834 S187P probably benign Het
Adam28 T C 14: 68,637,347 I294V probably benign Het
Adgrv1 T C 13: 81,503,004 I3057M possibly damaging Het
Aff4 T C 11: 53,375,596 V304A probably benign Het
Akr1b10 T C 6: 34,390,109 Y108H probably benign Het
Ankib1 T C 5: 3,713,163 N522S possibly damaging Het
Ano1 T A 7: 144,619,488 probably null Het
Antxr2 G T 5: 97,960,708 probably null Het
Arc G A 15: 74,671,195 T393I probably damaging Het
Arhgef33 A G 17: 80,381,354 D5G possibly damaging Het
Atf2 A T 2: 73,845,500 M169K possibly damaging Het
BC005624 T A 2: 30,973,937 T215S possibly damaging Het
BC048403 T C 10: 121,750,947 V253A possibly damaging Het
Bmp8b G A 4: 123,105,406 G19D unknown Het
Cacna1d T C 14: 30,042,920 N1987S probably damaging Het
Camta1 T A 4: 151,586,484 probably null Het
Catsperg2 C T 7: 29,700,696 G316D probably damaging Het
Cbs G T 17: 31,625,029 N209K probably benign Het
Ccdc122 T A 14: 77,091,759 M84K probably damaging Het
Cd5 C T 19: 10,723,285 C285Y probably damaging Het
Chpf2 T C 5: 24,590,421 M1T probably null Het
Coch T A 12: 51,595,372 D42E probably damaging Het
Crip2 C T 12: 113,140,558 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Cxcl16 G T 11: 70,455,408 P233H probably damaging Het
Cyfip1 T C 7: 55,886,781 I319T probably damaging Het
Ddhd2 T C 8: 25,741,321 Q364R probably damaging Het
Ephx2 A G 14: 66,086,963 probably null Het
Exoc6b C A 6: 84,855,522 V397L probably damaging Het
Fam83b T A 9: 76,492,928 K298* probably null Het
Fbxo8 T A 8: 56,591,529 I289N probably damaging Het
Fkbp9 T A 6: 56,878,104 M536K probably benign Het
Flot1 C T 17: 35,825,524 R190W possibly damaging Het
Gbp2b T A 3: 142,606,978 V374E probably benign Het
Gm884 T C 11: 103,619,838 T435A unknown Het
Gna15 T A 10: 81,512,556 S114C probably damaging Het
Gstt4 T A 10: 75,817,321 T136S probably benign Het
Hcn3 C T 3: 89,148,786 V524M probably damaging Het
Kctd16 A T 18: 40,258,563 D68V probably damaging Het
Krt90 G T 15: 101,560,425 F227L possibly damaging Het
Maip1 A G 1: 57,411,835 Y212C probably damaging Het
Mamdc2 C T 19: 23,378,869 D72N probably damaging Het
Marveld3 A T 8: 109,948,483 Y234N probably damaging Het
Mas1 A G 17: 12,841,747 I263T probably benign Het
Matk T A 10: 81,258,306 probably null Het
Mrgpre T A 7: 143,781,566 I67F possibly damaging Het
Mthfd1 T A 12: 76,294,174 I449N probably damaging Het
Nacc1 C T 8: 84,676,201 R321Q probably damaging Het
Neb T C 2: 52,258,681 D2618G probably damaging Het
Neb T C 2: 52,291,268 Y1109C probably damaging Het
Nell1 T G 7: 50,856,387 W781G probably damaging Het
Olfr1037 A C 2: 86,085,584 S64R probably benign Het
Olfr1279 T A 2: 111,306,980 Y258* probably null Het
Olfr281 T C 15: 98,457,078 L256S possibly damaging Het
Olfr424 A T 1: 174,137,415 I224F possibly damaging Het
Olfr497 C A 7: 108,422,577 A2D probably benign Het
Olfr544 T C 7: 102,484,443 I226V probably benign Het
Olfr646 T C 7: 104,106,294 L5P probably damaging Het
Pcdh7 C A 5: 57,721,315 D737E probably damaging Het
Pdss1 T G 2: 22,901,312 M55R probably benign Het
Pex6 C T 17: 46,724,700 R889W probably damaging Het
Pigl T A 11: 62,458,481 C8S possibly damaging Het
Plekha7 A T 7: 116,145,237 M585K probably damaging Het
Ppp1r1a C T 15: 103,533,087 M66I possibly damaging Het
Ptcd3 A T 6: 71,881,171 probably benign Het
Rhov A T 2: 119,271,014 V37E probably damaging Het
Rnf213 A T 11: 119,441,068 M2368L probably damaging Het
Skida1 T C 2: 18,046,157 probably benign Het
Slc25a28 T C 19: 43,666,953 D161G probably benign Het
Smc6 T C 12: 11,290,817 V490A probably damaging Het
Sohlh2 T A 3: 55,190,373 probably null Het
Stk31 A G 6: 49,417,495 T264A probably benign Het
Syngap1 T A 17: 26,954,988 S190R possibly damaging Het
Tacr1 T A 6: 82,552,901 V200E probably damaging Het
Tbrg4 C T 11: 6,620,812 R220H probably benign Het
Tcf20 A G 15: 82,852,303 L1649P probably benign Het
Tcirg1 A T 19: 3,897,866 L523Q possibly damaging Het
Tinag T A 9: 77,001,654 K335M possibly damaging Het
Tkt T G 14: 30,571,140 probably null Het
Tnpo1 C T 13: 98,863,812 R349H probably damaging Het
Trim26 T A 17: 36,852,618 S230R possibly damaging Het
Trim8 T A 19: 46,514,739 probably null Het
Trp53bp1 T C 2: 121,248,264 R326G probably null Het
Ugt2a2 A T 5: 87,460,639 I613N probably damaging Het
Vmn1r32 T C 6: 66,553,706 I29V probably benign Het
Wnt5b C T 6: 119,446,582 W27* probably null Het
Other mutations in Olfr1269
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Olfr1269 APN 2 90119068 missense probably damaging 1.00
IGL01518:Olfr1269 APN 2 90118971 missense possibly damaging 0.95
IGL01889:Olfr1269 APN 2 90118965 missense possibly damaging 0.84
IGL02629:Olfr1269 APN 2 90118857 nonsense probably null
R1446:Olfr1269 UTSW 2 90118858 missense probably damaging 0.98
R1938:Olfr1269 UTSW 2 90119083 missense probably damaging 0.97
R4526:Olfr1269 UTSW 2 90118672 missense probably benign 0.01
R4786:Olfr1269 UTSW 2 90119007 missense possibly damaging 0.95
R4792:Olfr1269 UTSW 2 90118830 missense possibly damaging 0.95
R4925:Olfr1269 UTSW 2 90118777 missense probably damaging 1.00
R5152:Olfr1269 UTSW 2 90119121 missense probably damaging 0.98
R5296:Olfr1269 UTSW 2 90118699 missense probably damaging 0.97
R5450:Olfr1269 UTSW 2 90118669 makesense probably null
R5536:Olfr1269 UTSW 2 90118839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCCTCCTATCCATGCTGTTC -3'
(R):5'- TGCTCCCTCATGGCTGACATACAC -3'

Sequencing Primer
(F):5'- TGTTCCCATGAGGACTGCAC -3'
(R):5'- TCTCTTCCAATCAAGAGGTGCAG -3'
Posted On2013-09-03